» Site Navigation
0 members and 1,775 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,055
Threads: 249,211
Posts: 2,572,728
Top Poster: JLC (31,651)
|
-
Re: for the experts
 Originally Posted by bobbittle
NERD says it's a random occurrence. I think the "faded" albinos and the "high contrast" albinos are more of a selectively bred trait, and not an actual mutation themselves. They are all just T- albinos. If it were a proven mutation, seperate from your every day albinos, you could breed a faded albino to any dark normal, and breed any of the hets together or back to the original faded albino and end up with all faded albinos every time. They wouldn't likely be compatible with your common T- albino, and the amount of xanthiphore in the breeding stock wouldn't have an effect on the faded homozygous albinos, and I don't know that to be the case.
-
-
Re: for the experts
Jake I feel like your right on with the line breeding thing. We've seen it in Lessers, Pastels, and even Cinni's.
I think the contrast is a line bred aberrant trait much like allot of the different "Lines" are in different morphs
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Re: for the experts
 Originally Posted by PythonWallace
I think the "faded" albinos and the "high contrast" albinos are more of a selectively bred trait, and not an actual mutation themselves.
 Originally Posted by Freakie_frog
Jake I feel like your right on with the line breeding thing. We've seen it in Lessers, Pastels, and even Cinni's.
I am inclined to disagree that it is a "line bred" occurrence. Lessers/pastels/cinnys that are born higher or lower grade stay higher or lower grade. A faded albino is born faded but eventually colours up to a point that you would not be able to tell it from an animal that was born high contrast. IDK if he has posted them here but on another forum Albey has some then and now pics of his faded albino, at birth it looked like a snow and now it looks like a really nice HC albino.
They are all just T- albinos. If it were a proven mutation, seperate from your every day albinos, you could breed a faded albino to any dark normal, and breed any of the hets together or back to the original faded albino and end up with all faded albinos every time. They wouldn't likely be compatible with your common T- albino, and the amount of xanthiphore in the breeding stock wouldn't have an effect on the faded homozygous albinos, and I don't know that to be the case.
It is possible to be a proven mutation that is "compatible" with a "common" T- albino. Based on some discussions on another forum I (and a few others it seems) are wondering if maybe the faded phenotype is the result of a second site mutation. If that is the case, depending on the mechanism of that second site mutation, breeding a faded to a normal and then breeding the offspring back together would give you a 1 in 8 or a 1 in 16 chance of getting a faded.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: for the experts
 Originally Posted by asplundii
I am inclined to disagree that it is a "line bred" occurrence. Lessers/pastels/cinnys that are born higher or lower grade stay higher or lower grade. A faded albino is born faded but eventually colours up to a point that you would not be able to tell it from an animal that was born high contrast. IDK if he has posted them here but on another forum Albey has some then and now pics of his faded albino, at birth it looked like a snow and now it looks like a really nice HC albino.
Correct but you can produce Mojaves that look like Lessers and Lessers the look like mojaves.
As for Pastels I can tell you with 100% certainty that you can breed a great looking pastel to a darker female and your offspring will show it.
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Re: for the experts
 Originally Posted by Freakie_frog
Correct but you can produce Mojaves that look like Lessers and Lessers the look like mojaves.
As for Pastels I can tell you with 100% certainty that you can breed a great looking pastel to a darker female and your offspring will show it.
You will not get any argument from me on those examples. But it does not change the fact that faded albinos are not the result of breeding for a faded looking animal. They just pop up. People are not taking "pale" adult albinos and breeding them to other "pale" animals with the intent of making faded albinos. As adults (or in just 2-3 sheds) the faded babies look like normals and most people likely do not know or care that they were born faded and just use them to make more albinos.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: for the experts
this it what he is looking like 
-
-
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
The Following User Says Thank You to Freakie_frog For This Useful Post:
-
Registered User
Re: for the experts
 Originally Posted by Freakie_frog
Yep he's a faded Albino
and he is 2 years now and still no change's after shedding
-
-
BPnet Veteran
Re: for the experts
wow you can barley see the yellow, i thought it was just white.
-
-
Re: for the experts
My SNAFU. I was thinking blush albinos not faded albinos.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|