Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 8,045

1 members and 8,044 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,060
Threads: 249,214
Posts: 2,572,756
Top Poster: JLC (31,651)
Welcome to our newest member, TillyMintz8613
Page 2 of 4 FirstFirst 1234 LastLast
Results 11 to 20 of 32
  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: How dangerous are these snakes to kids?

    Quote Originally Posted by nashveg View Post
    That being said, do I need to be there to supervise the kids with the snakes?
    2 words: HELL and YES!!

    My kids are used to walking up to me with big wolf spiders, big centipedes, assasin bugs, humongous slugs, and wild snakes in-hand. They're not afraid of much wildlife.
    When I was a kid I was just like your kids, walking around with everything I could get my hands on (caught my first snake when I was 4.) I was lucky, growing up where there was nothing of danger. Now that I have my own kid and living in a place where there are venomous snakes, she is not allowed to do any of the stupid things I did when I was a kid. I do not care if it is a ringneck snake she finds in the garden, if she wants to hold/touch it she has to come get me first. She is not allowed to get any of the snakes out on her own and she is never left alone with any of the snakes when they are out.

    Remember, SAFETY above all else.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    TheOtherLeadingBrand (07-13-2009)

  3. #12
    BPnet Veteran OFRD_GRL's Avatar
    Join Date
    06-03-2009
    Location
    Aurora, CO
    Posts
    347
    Thanks
    60
    Thanked 35 Times in 28 Posts

    Re: How dangerous are these snakes to kids?

    Just because the snake overtaking the kid isn't likely, doesn't mean it isn't possible. And supervision is a must. Until the kid moves out.

    I would rather be a strict snake mommy than a grieving parent, or upset that something bad happened (even if minute) because I was not around.

    Remember these are your children.
    ~Una
    0.2 Normal BP - Meerah & Tink
    0.0.1 Aberrant Albino Cali King Snake - "No Name"
    1.0 JCP - Lucky
    0.1 RTB - Leelah

  4. #13
    BPnet Royalty JLC's Avatar
    Join Date
    01-28-2004
    Location
    Alexandria, VA
    Posts
    31,651
    Thanks
    3,195
    Thanked 7,204 Times in 3,028 Posts
    Blog Entries
    37
    Images: 304

    Re: How dangerous are these snakes to kids?

    Quote Originally Posted by nashveg View Post

    That being said, do I need to be there to supervise the kids with the snakes? I tell them that they MUST tell me when they're taking the snakes out- and so far, they always have.
    There's RISK in everything we do. Allowing children to handle the snakes without you being nearby to keep a direct eye on them carries some fairly significant risks. A bite on the finger is probably not a big deal...but a bite to the face could be traumatic. Children getting hyper or distracted or childishly careless can cause serious injury to an animal without ever intending to.

    How much risk you want to accept and allow is up to you. Personally, I would never let my kids handle the snakes without being there to watch and keep an eye out. But that's how ~I~ do it. No one else can (or should) dictate how you deal with your own children. All we can do is point out the risks and make recommendations.
    -- Judy

  5. The Following User Says Thank You to JLC For This Useful Post:

    Omunall (07-11-2010)

  6. #14
    BPnet Veteran Clementine_3's Avatar
    Join Date
    04-26-2008
    Location
    Upstate NY
    Posts
    793
    Thanks
    96
    Thanked 140 Times in 135 Posts
    Images: 1

    Re: How dangerous are these snakes to kids?

    Quote Originally Posted by JLC View Post
    ...but a bite to the face could be traumatic.
    This is the first thing I thought of, it takes less than a second for a snake to get startled and strike (defensively). Sometimes you can read the snake and KNOW it's going to strike, I'm not sure how well a young child could read that though. Sometimes there is no warning, a quick hand movement or jerk and bam! Snakes don't care where they strike, if it's in reach and they are scared something is going to get tagged...I'd hate to know what a hard hit could do to an eye. They can hit hard too, I've had the bruises on my hand to remind me of that (I don't have BP's, I have Carpets but am sure BP's can hit just as hard when startled).
    When my nephews and nieces come over and want to 'hold' the snakes I let them. That amounts to me holding the snakes and them touching their tails. The older kids do get to actually hold them but I am standing right there watching like a hawk but still know anything can go wrong in a split second.
    Snakes are wild animals, anything can happen at any time and I do what I can to prevent that...that means watching them and the kids when they are together.

  7. #15
    BPnet Veteran Oroborous's Avatar
    Join Date
    04-20-2008
    Location
    Ashland, Oregon
    Posts
    865
    Thanks
    188
    Thanked 211 Times in 209 Posts
    Images: 10

    Re: How dangerous are these snakes to kids?

    Quote Originally Posted by nashveg View Post
    I know you guys have been around these snakes for years and probably don't even ponder the question, but I've got some pretty young kids and these snakes are strong.

    I just got a couple of young pythons a couple of weeks ago- the biggest one is about a year old, almost 3', and about as thick as a silver dollar. It wrapped around my 7 year old boy's neck once and he "couldn't get it off". My wife didn't like that one bit!!!! I also have a girl who turns 4 next week.

    A little help?
    IMO, ball pythons are completely harmless to children or any other person. They do not reach sizes capable of inflicting dangerous bites, and though they can squeeze pretty tightly, you'd have to be very weak not to be able to unravel their coils. With kids I always supervise them with my snakes, that's just a no brainer. And a little advice, it's easy to get a BP off you if its holding tight, just take hold of the base of the tail and unravel from there. But if your wife is worried, don't let the kids hold the snakes on their necks. That's also a good way to get bit in the face if the snake becomes frightened up there. Just my 2 cents.
    1.1ballpythons(normal)-Arwen, Montague
    1.0ballpython(pastel)-Shan Longshanks
    0.1ballpython(spider)-Pippa Willow
    1.0redtailboa-Inigo
    0.1redtailboa(salmon)-Imogen
    1.0redbloodpython-Fergis

  8. The Following User Says Thank You to Oroborous For This Useful Post:

    TheOtherLeadingBrand (07-13-2009)

  9. #16
    Apprentice SPAM Janitor MarkS's Avatar
    Join Date
    07-22-2005
    Location
    St Paul, MN
    Posts
    6,209
    Thanks
    1,535
    Thanked 2,678 Times in 1,596 Posts
    Blog Entries
    9
    Images: 3

    Re: How dangerous are these snakes to kids?

    Quote Originally Posted by nashveg View Post
    I know you guys have been around these snakes for years and probably don't even ponder the question, but I've got some pretty young kids and these snakes are strong.

    I just got a couple of young pythons a couple of weeks ago- the biggest one is about a year old, almost 3', and about as thick as a silver dollar. It wrapped around my 7 year old boy's neck once and he "couldn't get it off". My wife didn't like that one bit!!!! I also have a girl who turns 4 next week.

    A little help?
    What kind of pythons? If you're speaking of ball pythons, they are far less dangerous then your average house cat. But just like a house cat, if you do stupid things with them, you risk getting hurt. When I got a dog I cautioned the kids that they should never blow in the dogs face or try to mess with him while he's eating. The youngest boy, being the smart alec of the family, had to try blowing in the dogs face to see what would happen. Not surprisingly he got snapped at. He didn't actually get bit, but it would have served him right if he had. There are certain BASIC things that you need to know when dealing with animals. ANY kind of animal.

    Do NOT tease the dog while he's eating,
    Do NOT try to give the cat a bath,
    Do NOT stand directly behind the horse,
    Do NOT stick you fingers through the bars of the birds cage,
    Do NOT allow the snake to form a complete loop around your neck,

    These things are very very basic ideas you should know even before getting the animal.
    Draco dormiens nunquam titillandus

  10. #17
    BPnet Veteran OFRD_GRL's Avatar
    Join Date
    06-03-2009
    Location
    Aurora, CO
    Posts
    347
    Thanks
    60
    Thanked 35 Times in 28 Posts

    Re: How dangerous are these snakes to kids?

    Quote Originally Posted by MarkS View Post
    Do NOT stand directly behind the horse,
    I stand behind my horse all the time!!! (with the exception of when flies are biting) But then again he was a kicker when I got him and we worked on the whole if I am anywhere near you and you kick, you're in trouble.

    This statement is true in general speaking though
    ~Una
    0.2 Normal BP - Meerah & Tink
    0.0.1 Aberrant Albino Cali King Snake - "No Name"
    1.0 JCP - Lucky
    0.1 RTB - Leelah

  11. #18
    Registered User
    Join Date
    07-12-2009
    Posts
    11
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: How dangerous are these snakes to kids?

    To clarify- the snakes are ball pythons.

    I dunno- I just can't imagine anything other that a semi-scary bite happening- and if the kid gets scared... oh well.

    Our kids are constantly messing with the cat and the cat occasionally takes a swipe at them. The kids will get scratched- sometimes even blood is drawn- but they don't even fuss about it. I just can't imagine these snakes doing anything worse than that. My kids are always unsupervised with our cat. I think cats are probably the most capable predators on the planet- although much more affectionate than snakes- which are basically killing machines who might get "used to" being handled.

    I will make sure that the snakes are kept from their faces, though- that makes total sense. I'm usually one who challenges conventional wisdom or hard rules that don't seem to be based on substantial risk- and I'm not so sure I accept that I can't let my older kids (7 and 9) be with these young ball pythons unsupervised (with rules- like tell me when you take them out and don't let them get close to your head).

  12. #19
    BPnet Veteran
    Join Date
    10-08-2005
    Location
    Indiana
    Posts
    241
    Thanks
    11
    Thanked 18 Times in 13 Posts
    Images: 31

    Re: How dangerous are these snakes to kids?

    you may not like the idea of having a "rule" about the kids telling you that they are going to take out one of the snakes because of the ages of the children vs. the size of the snake (at this point in time).

    just please keep in mind what the wife will say/think if those children get one out and "forget" to put it back and close the cage up all the way (and there is a loose snake in the house).

    i'm not saying that the kids are irresponsable but rather you have to be the responsable one for the animal reguardless of the type of animal it is.

    you take these creatures into your home/heart as part of your family in a mannor of speaking and as such you have to think what is best for it not what is convient for you.

    as the adult in the family you have to look beyond the oh well if the kid gets bit it will learn not to touch it like that again... the object over all is to keep all (children and animals) safe using common sense.

  13. #20
    BPnet Lifer Kaorte's Avatar
    Join Date
    09-24-2008
    Location
    Chicago
    Posts
    8,773
    Thanks
    2,211
    Thanked 2,580 Times in 1,923 Posts
    Images: 13

    Re: How dangerous are these snakes to kids?

    At that age, I would be more worried about the snake.

    Just supervise the kids, it is the safest route for everyone.
    ~Steffe

Page 2 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1