Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 525

0 members and 525 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,090
Threads: 249,230
Posts: 2,572,849
Top Poster: JLC (31,651)
Welcome to our newest member, GhostsnSnakes
Page 1 of 4 1234 LastLast
Results 1 to 10 of 32
  1. #1
    Registered User
    Join Date
    07-12-2009
    Posts
    11
    Thanks
    0
    Thanked 0 Times in 0 Posts

    How dangerous are these snakes to kids?

    I know you guys have been around these snakes for years and probably don't even ponder the question, but I've got some pretty young kids and these snakes are strong.

    I just got a couple of young pythons a couple of weeks ago- the biggest one is about a year old, almost 3', and about as thick as a silver dollar. It wrapped around my 7 year old boy's neck once and he "couldn't get it off". My wife didn't like that one bit!!!! I also have a girl who turns 4 next week.

    A little help?

  2. #2
    BPnet Senior Member Denial's Avatar
    Join Date
    03-21-2009
    Location
    Greenville, SC
    Posts
    2,553
    Thanks
    775
    Thanked 657 Times in 327 Posts

    Re: How dangerous are these snakes to kids?

    IMO

    Snakes are not dangerous only stupid parents.

    I have 3 our of the 5 worlds largest constrictors and never ever worry about my children. If I thought for a second one could come into contact with one of my kids I would not own them. My kids love snakes and they love to help me clean cages and everything but they never go into the room without me. They do not go into the room when the big snakes are being cleaned they are not allowed in when its feeding time. THey do not know what snakes eat. They love all animals and I think they are still a little to young to know what they eat. THey do not know we breed rats. My snakes are locked in enclsoures (not fishtanks) in a padlocked room. Im the only one in the house with a key.

    And I wouldnt advice ever letting a snake around a childs neck.

    But as long as you are a responsible parent you should never encounter a problem. I would never put my child indanger. Loosing your life to a snake would be a horrible way to go I feel so bad for the little girl in florida and couldnt imagine what that child went thru during that but she had some pretty irresponsible adults in the household with her.

    Ball pythons are great snakes they get a perfect size and usually have great tempers. A perfect snake to be around children. My 5 and 2 year old love the ball pythons. But like I said as long as you take the right steps in keeping snakes like they should be kept you should be able to keep anything you desire without ever having to worry about your children.

  3. The Following 5 Users Say Thank You to Denial For This Useful Post:

    bobbittle (07-13-2009),dc4teg (07-20-2009),FlowRock (07-13-2009),takagari (07-14-2009),TheOtherLeadingBrand (07-13-2009)

  4. #3
    BPnet Royalty JLC's Avatar
    Join Date
    01-28-2004
    Location
    Alexandria, VA
    Posts
    31,651
    Thanks
    3,195
    Thanked 7,204 Times in 3,028 Posts
    Images: 304
    Blog Entries
    37

    Re: How dangerous are these snakes to kids?

    There has never been a documented incident of a ball python killing anyone. And I've never heard even a hint of anecdotal evidence of it either. And this is with millions of them being kept as pets.

    Just be responsible and careful. Don't EVER let the children handle the snakes unsupervised. And don't EVER put a snake around the neck of a child who is not fully confident of their ability to remove it, no matter how strong it is. The family dog, or even the family cat, can pose far more risk to the children in the household than a ball python would...but I still wouldn't put one around the neck of a young child.
    -- Judy

  5. The Following 2 Users Say Thank You to JLC For This Useful Post:

    bobbittle (07-13-2009),TheOtherLeadingBrand (07-13-2009)

  6. #4
    BPnet Lifer wolfy-hound's Avatar
    Join Date
    10-10-2005
    Location
    Florida
    Posts
    5,505
    Thanks
    2,128
    Thanked 2,221 Times in 1,151 Posts
    Images: 23

    Re: How dangerous are these snakes to kids?

    A toy poodle could probably do ten times the damage to your kid that a ball python can. As long as you supervise them with the snakes, as any good parent should, there should be no danger at all.
    Don't encourage your kids to put snakes around their neck. I don't think that the ball python could harm them, but if your kid panics, he could hurt himself, or the snake.
    Theresa Baker
    No Legs and More
    Florida, USA
    "Stop being a wimpy monkey,; bare some teeth, steal some food and fling poo with the alphas. "

  7. #5
    BPnet Veteran OFRD_GRL's Avatar
    Join Date
    06-03-2009
    Location
    Aurora, CO
    Posts
    347
    Thanks
    60
    Thanked 35 Times in 28 Posts

    Re: How dangerous are these snakes to kids?

    I would always always keep your snakes locked up. Not because you have children, but because it is the responsible thing to do.

    We have 2 kids on the weekends... and we have a 6ft+ red tail, 4ft ball python, 3.5ft-4ft carpet python and then a 2ft king snake...

    They have learned the responsible way to hold snakes, to NEVER touch the snakes without our permission, and for us to always be present. And our snakes are locked up otherwise.

    When they were just teeny there was a 11ft red tail in the house with them. Totally secured. And they got to play with it under supervision (im just a "step mom" so I wasnt around then..)

    Ball Pythons by nature are timid and very docile (and much slower in movement than some other snakes), so for children to get used to snakes, in my opinion, they are perfect!

    Good luck & enjoy!
    ~Una
    0.2 Normal BP - Meerah & Tink
    0.0.1 Aberrant Albino Cali King Snake - "No Name"
    1.0 JCP - Lucky
    0.1 RTB - Leelah

  8. #6
    BPnet Veteran Michelle.C's Avatar
    Join Date
    03-23-2007
    Location
    Battle Creek, MI
    Posts
    1,188
    Thanks
    431
    Thanked 398 Times in 279 Posts
    Images: 13

    Re: How dangerous are these snakes to kids?

    I have very young children over at my house all of the time. They are ages 3-14. We supervise their activities with the snakes, but we haven't had once incident where the children were hurt or I feared for their safety at all.

    Honestly, we have more problems with one of our seven Rough Coat Collies accidentally knocking one of them down than anything. They have big hearts but they aren't as graceful as the Lassie on TV.

    Let me assure you, your children and animals are safe as long as there is supervision.

    There is a rule, with even the smallest snake. Never allow them to wrap around your neck (or your children's), at any point. You can carry them on one shoulder, but always have your hand between their body and your neck. With the children, I wouldn't allow them around their neck, shoulders, or face anyway, it's irresponsible. Children do not always practice proper sanitizing rituals after handling reptiles.


  9. The Following 2 Users Say Thank You to Michelle.C For This Useful Post:

    takagari (07-14-2009),TheOtherLeadingBrand (07-13-2009)

  10. #7
    BPnet Veteran frankykeno's Avatar
    Join Date
    04-17-2005
    Location
    Toledo, Ohio
    Posts
    19,814
    Thanks
    92
    Thanked 871 Times in 478 Posts
    Images: 33

    Re: How dangerous are these snakes to kids?

    Like many have said here, we have a house policy that no snake no matter what species, size or age goes around anyone's neck. We model this behaviour for our 4 kids by the way we show them how to handle the snakes. No one, even the teenagers that own their own snakes, removes a snake from it's enclosure without permission of either Mike or I. Are 9 foot boa constrictor is kept in a secure enclosure with a keyed padlock. Only my husband and I hold the keys to that enclosure.

    We also practise respectful handling and have taught our children that the snake will show you if you watch and use your brain and instincts, how much it can take of your messing with it. The snakes needs come before our wishes to handle it. It's a good lesson in patience for children I think.

    Lastly the house rule is to always wash after handling a snake and no kissing the snakes like some kids want to do. Actually the standing rule in the house that applies to all pets is that if it can lick it's own butt (or in the case slither through it's own poop) you do NOT kiss the darn thing or let it lick near your mouth.
    ~~Joanna~~

  11. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: How dangerous are these snakes to kids?

    Like everyone has said so far, the snakes in and of themselves are not the problem, the parents are. You never leave a child unsupervised with any pet be it snake or spider or bird or cat or dog or horse.

    FWIW, I have a 5 y.o. and she has been raised with snakes. She has been "handeling" out oldest ball since she was 3 (with supervision, me holding the head and front end, her "holding" (read "petting" the tail.)

    Never let a snake wrap around a childs neck. I would not even allow a less strong snake (rat, king, corn) to drape over a child's shoulders as there would be too much potential for possible problems.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  12. #9
    Registered User Muze's Avatar
    Join Date
    08-08-2008
    Location
    Ft. Lauderdale
    Posts
    1,055
    Thanks
    370
    Thanked 207 Times in 174 Posts

    Re: How dangerous are these snakes to kids?

    I do not have children at home, and very seldom do we have any child visitors. However, I never wrap any of my snakes around my neck (or allow anyone else to), or even have them near my face. They are wild animals, docile as they are. I had one confuse my arm for prey, wrap around, and bite. I do not wish to experience this on my face.

    That being said, I think they are perfectly safe around children as long as there is supervision. I also only bring out my most outgoing snakes that I know very well to interact with guests. The ones that do tolerate handling well (as in try to leave your arm as quickly as possible), etc., I do not introduce to guests.

    I would pretty much take the same precautions with children around my dogs, as I would my BPs.
    _____________________________________________
    Ivy
    _____________________________________________
    BPs: 1.0 Normals,1.0 Pastels, 0.1 Dinkers
    Other Herps:
    6.20 Bearded Dragons (Hypos, Trans, Leathebacks, Reds, etc.), 1.1 Knob Tail Geckos
    Other:
    0.1 Mini American Eskimos, 1.0 Chihuahuas, 0.1 Terrier Mixes, 1.0 Chihuahua/Toy Fox Terrier Mixes
    1.0 Double Rex, 0.1 Beige Ruby Eyed Dumbo, 0.1 Hairless PEW

  13. #10
    Registered User
    Join Date
    07-12-2009
    Posts
    11
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: How dangerous are these snakes to kids?

    OK. So let me get this straight...

    Keep the snakes away from heads/faces. Wash hands before and after care. Got it.

    That being said, do I need to be there to supervise the kids with the snakes? I tell them that they MUST tell me when they're taking the snakes out- and so far, they always have.

    These snakes are still pretty small. If a snake bites one of them, I don't think my kids would care much. My 9-year old daughter even told me she wishes one would bite her so she would know how much it hurts. I can't imagine it hurts much. And from what I'm hearing, a snake over-taking one of the kids isn't a possibility?

    My kids are used to walking up to me with big wolf spiders, big centipedes, assasin bugs, humongous slugs, and wild snakes in-hand. They're not afraid of much wildlife.

Page 1 of 4 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1