Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,912

0 members and 1,912 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,103
Threads: 249,251
Posts: 2,572,971
Top Poster: JLC (31,651)
Welcome to our newest member, divineroyals
Page 1 of 2 12 LastLast
Results 1 to 10 of 13
  1. #1
    BPnet Veteran Ladydragon's Avatar
    Join Date
    04-07-2007
    Location
    edge of insanity or PA take your pic. :D
    Posts
    2,630
    Thanks
    285
    Thanked 239 Times in 213 Posts
    Images: 22

    Gray tree frog tadpoles....... HELP!!!!!!

    Okay... went over to a friends house this past Sunday to help them open up their in-ground pool. When we removed the cover we all stopped to stare in surprise at the "bog" that lay before us. Speculation is that not enough Shock was put into the pool before it was closed last year.

    Sitting on the sides of the pool were several adult Gray tree frogs and thousands (I'm not kidding!!!) of tadpoles swimming about. I grabbed a small tupperware container to scoop up some tadpoles so that my kids can watch them change and grow.

    Here is my problem, I have no clue on how to take care of them. I've searched around a bit but I'm not finding the information I need. I stopped at the pet store and picked up some frog/tadpole food but I'm clueless on the rest. I have a small 5 gallon tank I can set them up in for now. Can I put a fluval filter into the water to help keep it clean or will that be bad for them?

    any other info would be greatly appreciated. Or point me in the right direction.

    Side note: I didn't have a camera with me so no pics of the "bog" but I will get pics of the tadpoles up soon. thanx.
    Doris



  2. #2
    BPnet Lifer wolfy-hound's Avatar
    Join Date
    10-10-2005
    Location
    Florida
    Posts
    5,505
    Thanks
    2,128
    Thanked 2,221 Times in 1,151 Posts
    Images: 23

    Re: Gray tree frog tadpoles....... HELP!!!!!!

    You can do water changes to keep the tank clean. I just got a lot of advice on my new tadpoles..
    "Hi.
    Tadpoles will stay tadpoles in cold water or start to metamorph in 76 or above water, either way you have a couple months before theyre froglets. they eat
    Rinsed green pond algae
    Duckweed
    Elodea/Anachris
    *Algae Wafers
    *Goldfish & Spirulina flakes
    *Frozen mixed greens, they can be fed just the last 3 and be fine...
    10 gal. 3/4 full is fine for a few tadpoles. Froglets do good in 1" water w/ floats or 20 % land area.. use bottled spring water or well aged dechlorinated tap water only - and filter or better yet change often w/ tadpoles "

    That's what I was told for mine. I hope this helps you out!
    Theresa Baker
    No Legs and More
    Florida, USA
    "Stop being a wimpy monkey,; bare some teeth, steal some food and fling poo with the alphas. "

  3. The Following User Says Thank You to wolfy-hound For This Useful Post:

    Ladydragon (06-04-2009)

  4. #3
    BPnet Veteran Ladydragon's Avatar
    Join Date
    04-07-2007
    Location
    edge of insanity or PA take your pic. :D
    Posts
    2,630
    Thanks
    285
    Thanked 239 Times in 213 Posts
    Images: 22

    Re: Gray tree frog tadpoles....... HELP!!!!!!

    thanx theresa... it does help me. I have the fluval filter and a small tank heater which I can set up for them as well. I also found out that you can use one of those dechlorination products you use for fish so I'll do that too.
    Doris



  5. #4
    BPnet Veteran
    Join Date
    09-14-2007
    Location
    Northern Virginia
    Posts
    3,250
    Thanks
    170
    Thanked 703 Times in 538 Posts

    Re: Gray tree frog tadpoles....... HELP!!!!!!

    I have raised tadpoles twice in my life.

    Once was WAY back when I was a teen or maybe even a pre-teen. I kept them in a bucket that I refilled with water directly out of the hose. I'm sure the water had to have chlorine in it, but it didn't seem to affect them. I do not remember doing anything to change or clean the water, just topped it off when needed due to evaporation. I kept them out in the full sun (looking back, I'm amazed they didn't cook), and enough algae grew that apparently they did not need any additional food. They appeared to my unknowledgeable eyes to be perfectly healthy, and they did grow legs, climb out of the bucket using a stick I put in there as a ramp, and disappear back into the wild. I believe they were toads.

    Once was about 3 or 4 years ago. I kept them in a 10 gallon tank, kept their water clean, dechlorinated, and fed them goldfish food, based on info I found on the internet. They also appeared to be perfectly healthy, grew legs, luckily did not climb out of the 10 gallon tank since it was kept in our house, and we released them into the wild. We did lose a few that seemed to drown once they had grown their legs. We did have rocks for them to climb onto, so not really sure why the ones that died didn't use it or maybe it wasn't drowning. I really don't know. These ones were frogs.

    So, based on my experiences, they are pretty hardy and a wide range of things will work. Of course, I'm sure some species would be more delicate than others.

    Good luck with yours! They are really amazingly cute when they first change!
    Casey

  6. The Following User Says Thank You to kc261 For This Useful Post:

    Ladydragon (06-04-2009)

  7. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Gray tree frog tadpoles....... HELP!!!!!!

    The info here has been pretty good so I will only gently revisit it.

    Tropical micro pellet fish food (little granuels that sink rather than float) is good. Algae wafers are great if you can find them. I also recommend at least one attemp with dried bloodworms, even the "veggie" tads of some species will occasionally take these and the variety can be good for development.

    Weekly water changes. Some people recommend keeping some of the old water in at each change but I prefer to do a full change

    If you can get your hands on some java moss that may help you. It works great when rearing Dendro tads and I imagine it would work for greys too.

    Also, just a personal preference of mine, but I prefer to use deli cups and do one tad per cup. That way you know that each tad is getting a share of the food. Plus, when they start to morph, if they are on different schedules you can work with individuals rather than trying to accomodate all ranges of conditions in one tank for multiple stages of development.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following User Says Thank You to asplundii For This Useful Post:

    Ladydragon (06-04-2009)

  9. #6
    BPnet Veteran Ladydragon's Avatar
    Join Date
    04-07-2007
    Location
    edge of insanity or PA take your pic. :D
    Posts
    2,630
    Thanks
    285
    Thanked 239 Times in 213 Posts
    Images: 22

    Re: Gray tree frog tadpoles....... HELP!!!!!!

    so I put them into a 5 gallon I had sitting around doing nothing. I filled it last night about 1/2 way, and I found a jar of Stress Coat with additives to remove chlorine and metals in water (used it for my betta fish) and let the tank sit over night. Put the tads in this morning and they were all swimming about nicely. I go to move the tank and "crack" the glass breaks... thank goodness not a huge gush of water, but a steady drip so I was able to transfer them to a small fish bowl I had. so now I need to get a new tank for them. But I will try to find algea wafers and the java moss to make it more friendly for them. thanx for the help everyone and keep it coming.
    Doris



  10. #7
    BPnet Veteran littleindiangirl's Avatar
    Join Date
    03-31-2007
    Posts
    8,193
    Thanks
    637
    Thanked 795 Times in 487 Posts
    Images: 25

    Re: Gray tree frog tadpoles....... HELP!!!!!!

    Chlorine will evaporate if you leave it uncovered.

  11. #8
    BPnet Veteran Ladydragon's Avatar
    Join Date
    04-07-2007
    Location
    edge of insanity or PA take your pic. :D
    Posts
    2,630
    Thanks
    285
    Thanked 239 Times in 213 Posts
    Images: 22

    Update on tadpoles I rescued

    well.. update on those tadpoles... I had 9.. and now only have one.. the others vanished over night but i couldn't find them anywhere including inside the filter.. which led me to believe that the remaining tadpole was the culprit. Hope his siblings tasted good to him.... (if that is possible I couldn't find them anywhere and I couldn't find anything about tads eating other tads). So, now the remaining tad has turned into a frog and he is tiny and green (thought he was supposed to be grey).. either way he is cute. Please ignore the not so great pics but here are a few pics of the hopper...





    Doris



  12. #9
    BPnet Veteran musicalKeyes's Avatar
    Join Date
    07-14-2009
    Location
    Chicago-ish
    Posts
    349
    Thanks
    115
    Thanked 63 Times in 43 Posts
    Images: 1

    Re: Gray tree frog tadpoles....... HELP!!!!!!

    I have seven grey tree frogs at the moment, and they are about three weeks old. I got them just out of the tadpole stage. Grey tree frogs have the ability to change color from grey to green to brown, depending on what surface they are on, and are often referred to as the "chameleon" of the frog world. I have my guys in a twenty gallon now, and on small crickets.

    If you don't know this already, your little guy should be eating anywhere from 1-3 ten day old crickets every day or every other day. Pinheads work, but he'll need to eat more of them. Make sure you get a calcium powder (I use rep-cal) to dust them with. With any luck, he'll be his adult size within the year (anywhere from 2 to 4(!) inches).

    Good luck, I hope this helped. :]

  13. #10
    BPnet Veteran cinderbird's Avatar
    Join Date
    08-20-2007
    Location
    Silver Spring, MD
    Posts
    2,170
    Thanks
    551
    Thanked 480 Times in 363 Posts
    Images: 4

    Re: Gray tree frog tadpoles....... HELP!!!!!!

    omg so cute and little!

    if they are the same species of grey tree frog that i am thinking of, then the adults have an irritating layer of slime/coating on them. I have no idea with juveniles. The irritant can cause burning and stinging if it gets in the eyes so just make sure you wash your hands after handling (not that i should have to tell you).


Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1