» Site Navigation
3 members and 2,944 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,050
Threads: 249,210
Posts: 2,572,721
Top Poster: JLC (31,651)
|
-
Registered User
genetic question
what does i can get if i breed whith thise 2 bp
tigre and spaider
-
-
Re: genetic question
This is going to depend on what you concidering a Tiger. There are two different morphs named tiger. One is a Genetic banded animal the other is a combo made by breeding an Enchi X Desert.
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Registered User
-
-
Registered User
-
-
Re: genetic question
The prior would give you an Enchi x Desert x Spider. Probably look like a reduced spider that is pretty bright with high yellow
The latter would most likely give you a reduced spider
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: genetic question
 Originally Posted by asplundii
The prior would give you an Enchi x Desert x Spider. Probably look like a reduced spider that is pretty bright with high yellow
The latter would most likely give you a reduced spider
ammmmmmmmmm and where can i get a pic of that spaider????
-
-
Registered User
Re: genetic question
and well i think that to get that i shoul het an spaider het tigre no????
-
-
Registered User
Re: genetic question
 Originally Posted by ballpythonh
and well i think that to get that i shoul get an spaider het tigre no????
-
-
Registered User
Re: genetic question
sorry abou that mistake of puttind het were was a get hahaha
-
-
Re: genetic question
 Originally Posted by ballpythonh
and well i think that to get that i shoul het an spaider het tigre no????
No hets involved. All the traits are dominant/co-dominant...
As far as pics of spiders... They are all over the web. I would suggest ProExotics site for pics of the Desert x Spider and the Desert x Enchi. Imagine them melded and you should have an idea of the triple combo...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|