Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 673

1 members and 672 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
Welcome to our newest member, KBFalconer
Page 2 of 4 FirstFirst 1234 LastLast
Results 11 to 20 of 40
  1. #11
    BPnet Veteran Spaniard's Avatar
    Join Date
    08-02-2006
    Location
    Farmingdale, Long Island
    Posts
    4,405
    Thanks
    355
    Thanked 580 Times in 487 Posts
    Images: 2

    Re: Do all morphs have diffrent personalities?

    Quote Originally Posted by th3jok3r View Post
    thanks guys i was just wonderiing beause i know that these "orphs" are all genetic defects like the super cinny with kinks and the spiders head wobble so i was wondering if any others have other defects which is what i meant by personalities
    Caramels are known for kinks not Cinnies.
    ~*Rich
    1.0 100% Het Albino
    1.3 Normal
    1.0 Spider
    0.1 Mojave
    1.0 Pastel 100% Het Goldfinger
    0.1 Pastel 66% Het Goldfinger
    0.1 Pastel PH Goldfinger


  2. #12
    BPnet Veteran th3jok3r's Avatar
    Join Date
    05-15-2009
    Location
    Newburgh, NY
    Posts
    277
    Thanks
    35
    Thanked 21 Times in 21 Posts

    Re: Do all morphs have diffrent personalities?

    oo yea thats right and supper cinniy's have something wrong with their heads or something i dont remeber

  3. #13
    BPnet Veteran
    Join Date
    09-14-2007
    Location
    Northern Virginia
    Posts
    3,250
    Thanks
    170
    Thanked 703 Times in 538 Posts

    Re: Do all morphs have diffrent personalities?

    Quote Originally Posted by Spaniard View Post
    Spiders were healthy enough to survive in the wild in order to be imported here for the pet trade.
    Were they? I believe only one wild spider has ever been found, and all of our captive spiders are descended from that one animal. I have no idea if he was an adult, or maybe even a CH, which would mean he never was in the wild at all. I suspect the wobbling issues may be related to why another wild spider has never been found. If he was CH, or if he was young when captured, maybe he is the original mutant, and just never got a chance to breed. Or maybe he is the original mutant, was able to survive ok, but his wobbling preventing him from breeding in the wild. Who knows? But even if spiders may not be able to survive and reproduce in the wild, that doesn't mean that most of them aren't plenty healthy enough to be just fine in captivity. Albinos don't do too well in the wild either, but just because they are an easy target for a predator doesn't have any negative affect on them in captivity at all.

    Quote Originally Posted by Spaniard View Post
    Adding the spider gene to a combo morph seems to strengthen it and reduces the frequency of wobbles appearing in combos vs. the spider gene on its own.
    I've heard this before, and I'm not saying you are wrong, but it makes no sense to me. It is not like a spider has fewer genes than a spider combo. Why would pastel, for example, reduce the wobbles any more than the normal gene on the pastel locus? I wonder if this is just a rumor, or if it is true, does anyone have any explanation for it?

    Quote Originally Posted by CamStatic View Post
    Is it right to keep on breeding animals with defects, just because they are beautiful? And I'm not thinking mainly about spiders, but also other animals who suffers from humans aggressive ways of breeding beyond all common sense when it comes to their pets appearances. The English Bulldog and similar breeds are just a few of the examples where selective breeding has gone way too far and animals are suffering badly.
    I think there is a BIG difference between selecting for something like a deformed nose that interferes with the dog's ability to breathe, and selecting for a color pattern.

    Also, you reported that one of your enigma leo babies does not circle. If selective breeding can keep the pretty color pattern, but reduce or eliminate the circling problem, do you still have a problem with breeding enigmas? (I don't actually know anything about enigmas, so I don't know how likely this is, but just asking if...)

    I've not been aware of BP morphs for long enough to be sure, but it seems to be that there are fewer problems with caramels kinking than there used to be. Maybe all the outcrossing that has been done as people produce hets and combos has helped. Also, some people are trying to find ways to avoid it, for example I remember reading about someone (Tim Bailey maybe?) who was keeping track of some stuff regarding humidity during incubation because there may be a correlation.

    So I think there is lots of possibilities to reduce or eliminate some of the problems that are seen with some of the reptile morphs. Reptile breeding is still in its infancy compared to something like dog breeding. I actually think the reptile world is doing WONDERFULLY by selecting for colors. Compare it to such things as the already mentioned dog breeds, or long fins on fish which make it hard for them to swim, or quarter horses with tiny feet which often caused lameness issues, and you'll probably agree we could be doing a lot worse.
    Casey

  4. #14
    Registered User tom s4wy3r's Avatar
    Join Date
    02-25-2009
    Posts
    38
    Thanks
    2
    Thanked 4 Times in 4 Posts
    Images: 2

    Re: Do all morphs have diffrent personalities?

    this has nothing to do with spider wobbles but i do know that the camel albino morph has common kinking.or maybe it was just carmels? either way carmel morphs are known for kinking
    1.1 normal
    1.1 het albino
    1.0 pastel
    1.0 SHTCT leo
    0.1 normal leo
    0.2 rainwater blazing blizzard

  5. #15
    BPnet Veteran Spaniard's Avatar
    Join Date
    08-02-2006
    Location
    Farmingdale, Long Island
    Posts
    4,405
    Thanks
    355
    Thanked 580 Times in 487 Posts
    Images: 2

    Re: Do all morphs have diffrent personalities?

    I've heard this before, and I'm not saying you are wrong, but it makes no sense to me. It is not like a spider has fewer genes than a spider combo. Why would pastel, for example, reduce the wobbles any more than the normal gene on the pastel locus? I wonder if this is just a rumor, or if it is true, does anyone have any explanation for it?
    This is a statement I've heard many times over the last couple years; is it rumor? I guess it could be.

    We see many posts about people and their spiders exhibiting some sort of wobble? Where are all the bumble bee, honeybee, lesserbee etcs. that show wobbles? I can think of one post a member here had of a bumble bee with wobbles and thats all. The combos have become more common I would have expected some more threads on the topic if spider combos were showing wobble signs.

    Maybe we should start a poll thread with the different spider combos and ask users to vote if they exhibit wobbles.
    ~*Rich
    1.0 100% Het Albino
    1.3 Normal
    1.0 Spider
    0.1 Mojave
    1.0 Pastel 100% Het Goldfinger
    0.1 Pastel 66% Het Goldfinger
    0.1 Pastel PH Goldfinger


  6. #16
    BPnet Veteran
    Join Date
    11-13-2003
    Location
    Colorado
    Posts
    1,555
    Thanks
    6
    Thanked 247 Times in 186 Posts
    Images: 28

    Re: Do all morphs have diffrent personalities?

    Quote Originally Posted by Spaniard View Post
    Caramels are known for kinks not Cinnies.
    Actually homozygous cinnamon have both tendencies to duck bill and kink going on. It's probably just easier to hide a kink in a picture.

    I remember when the spinning thing first went public for spiders (years and years into the project) it was thought that the combos spun more because some of the first combos at shows where wobblers. My theory is that there where enough regular spiders to pick from that only non spinners where taken to the show but the first combos where so neat that they where taken even if spinning.

  7. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Do all morphs have diffrent personalities?

    Quote Originally Posted by kc261 View Post
    I've heard this before, and I'm not saying you are wrong, but it makes no sense to me. It is not like a spider has fewer genes than a spider combo. Why would pastel, for example, reduce the wobbles any more than the normal gene on the pastel locus? I wonder if this is just a rumor, or if it is true, does anyone have any explanation for it?
    I am inclined to agree with you KC. "Wobble" comes from the spider gene, adding some other morph to the mix does not remove the spider gene. I think the reason we have this rumor is the same as the reason there is an identical rumor on Jag carpets when coupled with other morphs. The combo animals are higher cash animals and the last thing a breeder selling a lesserbee or a spinnerblast wants to contend with is losing a sale because of "wobble"...

    Quote Originally Posted by Spaniard View Post
    We see many posts about people and their spiders exhibiting some sort of wobble? Where are all the bumble bee, honeybee, lesserbee etcs. that show wobbles? I can think of one post a member here had of a bumble bee with wobbles and thats all.
    There is a YouTube vid of a spinner that is going total spaz. And at shows I have seen multiple bees twirling. They are out there, you just have to look.

    The combos have become more common I would have expected some more threads on the topic if spider combos were showing wobble signs.
    As I said above, I think the combos do wobble but people just do not talk about it. Hell, there is still a fracas every time someone brings up their normal spider having "wobble", how big a tempest in a teacup do you think it would make if people were to start bringing up their train-wreck queenbees?? There is a stigma about the "wobble" in spiders. All spiders "wobble". Period. It may be minor, it may be major but it is always there. Kevin has said it. Ralph has said it. Why we can not just accept that and move on I do not understand. They live fine, they eat fine, they shed fine, they defecate fine. So why is it that everyone with a spider can not just accept that, yeah, they are a little tweak?? If you do not like the idea of an animal that "wobbles" then just do not get a spider. If you like the way the spider looks and you do not mind the "wobble" then go get a spider...

    Maybe we should start a poll thread with the different spider combos and ask users to vote if they exhibit wobbles.
    Maybe I am remembering wrong but I am pretty sure there is one on here somewhere...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #18
    Old enough to remember. Freakie_frog's Avatar
    Join Date
    08-12-2004
    Location
    221b Baker Street
    Posts
    16,636
    Thanks
    462
    Thanked 3,884 Times in 2,148 Posts
    Blog Entries
    2
    Images: 107

    Re: Do all morphs have diffrent personalities?

    Quote Originally Posted by kc261 View Post
    Were they? I believe only one wild spider has ever been found, and all of our captive spiders are descended from that one animal. I have no idea if he was an adult, or maybe even a CH, which would mean he never was in the wild at all. I suspect the wobbling issues may be related to why another wild spider has never been found. If he was CH, or if he was young when captured, maybe he is the original mutant, and just never got a chance to breed. Or maybe he is the original mutant, was able to survive ok, but his wobbling preventing him from breeding in the wild. Who knows? But even if spiders may not be able to survive and reproduce in the wild, that doesn't mean that most of them aren't plenty healthy enough to be just fine in captivity. Albinos don't do too well in the wild either, but just because they are an easy target for a predator doesn't have any negative affect on them in captivity at all.
    The first spider was a WC Juvi if memory serves. Does this mean that he is the only spider ever produced in the wild..My thoughts would be no..Since its a "dominate" gene either its mom or dad had to look like a spider .



    I've heard this before, and I'm not saying you are wrong, but it makes no sense to me. It is not like a spider has fewer genes than a spider combo. Why would pastel, for example, reduce the wobbles any more than the normal gene on the pastel locus? I wonder if this is just a rumor, or if it is true, does anyone have any explanation for it?
    Because we don't know the exact reason that a spider wobbles it is possible that it is missing something on the genetic level that can be replaced by adding another gene in with it. We just don't know.


    I've not been aware of BP morphs for long enough to be sure, but it seems to be that there are fewer problems with caramels kinking than there used to be. Maybe all the outcrossing that has been done as people produce hets and combos has helped. Also, some people are trying to find ways to avoid it, for example I remember reading about someone (Tim Bailey maybe?) who was keeping track of some stuff regarding humidity during incubation because there may be a correlation.
    Or maybe because there is such a huge stink about the kinking that breeders are just not admitting they produce them or aren't showing them to people. There is a theory that the internal pressure of the egg can increase the risk of kinking in the Caramels. Tims idea is to lower the humidity and by doing so reducing the internal pressure of the egg. Its still just a theory..It also may be genetic like scoliosis in people


    So I think there is lots of possibilities to reduce or eliminate some of the problems that are seen with some of the reptile morphs. Reptile breeding is still in its infancy compared to something like dog breeding. I actually think the reptile world is doing WONDERFULLY by selecting for colors. Compare it to such things as the already mentioned dog breeds, or long fins on fish which make it hard for them to swim, or quarter horses with tiny feet which often caused lameness issues, and you'll probably agree we could be doing a lot worse.
    I agree I my mind we are doing better at trying to produce better quality animals. In time we may see some of the problems and oddity's we are now facing be bred out.
    When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban
    "for the discerning collector"



  9. #19
    BPnet Veteran Spaniard's Avatar
    Join Date
    08-02-2006
    Location
    Farmingdale, Long Island
    Posts
    4,405
    Thanks
    355
    Thanked 580 Times in 487 Posts
    Images: 2

    Re: Do all morphs have diffrent personalities?

    I haven't really done much searching on youtube, but I will. I've no doubt that spiders have wobbles or that combo morphs exhibit it as well. But I honestly thought the frequency in its occurance in combos was reduced.

    I think its a shame that there is so much uncertainty and misinformation regarding such a commonly used combo trait. I'm sure I'm not the only one that thought combos were at a lower risk.
    ~*Rich
    1.0 100% Het Albino
    1.3 Normal
    1.0 Spider
    0.1 Mojave
    1.0 Pastel 100% Het Goldfinger
    0.1 Pastel 66% Het Goldfinger
    0.1 Pastel PH Goldfinger


  10. #20
    BPnet Veteran Serpent_Nirvana's Avatar
    Join Date
    06-15-2009
    Location
    New England
    Posts
    842
    Thanks
    357
    Thanked 303 Times in 216 Posts

    Re: Do all morphs have diffrent personalities?

    Quote Originally Posted by Freakie_frog View Post
    The first spider was a WC Juvi if memory serves. Does this mean that he is the only spider ever produced in the wild..My thoughts would be no..Since its a "dominate" gene either its mom or dad had to look like a spider .
    Not necessarily ... It's entirely possible that the first spider imported was one that arose through spontaneous mutation.

    Because we don't know the exact reason that a spider wobbles it is possible that it is missing something on the genetic level that can be replaced by adding another gene in with it. We just don't know.
    I tend to doubt that ... I guess it is theoretically possible, as we know so little about why, on a molecular level, most mutations manifest the way they do phenotypically, but I have a hard time envisioning that. For example, we could pretend that a spider looks like a spider because its neural crest cells migrate improperly (some NC cells being melanocyte precursors), and that this also somehow affects the migration of certain cells to some part of its nervous system, causing neuro signs. Now pretend that pastel occurs because the pastel has a mutation that decreases the amount of melanin produced. ... I just don't see how that pastel mutation (less melanin) is going to help make up for the improper NC cell/melanocyte migration mutation. (All of this is just speculation of course -- I have no idea what's going on on a molecular level to cause the spider phenotype -- but my point is that I have a hard time seeing a molecular reason that other mutations could "fix" the spider wobble.)

    Does anyone know if the spider is truly just "dominant" -- meaning that homozygous spiders exist, and just look identical to the heterozygous form -- or if spider is homozygous lethal?

    What I wonder is whether the wobble is caused by the spider mutation itself (some epistatic effect), or whether the "wobble gene" is just very close to the "spider gene" on the chromosome, so they're currently linked. If it's the former, I'm not totally sure how it would be possible to "breed out" the wobble -- seems like then it would just be a part of the spiders that we have to accept (or fail to accept, and therefore choose not to work with the mutation). If it's linkage, though, with enough outcrossing we could potentially get rid of that wobble gene ...

Page 2 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1