Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,658

0 members and 1,658 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,934
Threads: 249,128
Posts: 2,572,279
Top Poster: JLC (31,651)
Welcome to our newest member, LavadaCanc
Results 1 to 8 of 8

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Line Breeding / Outcrossing

    Quote Originally Posted by Freakie_frog View Post
    I know that RDR started seeing issues when line breeding his granite Albino project. He was getting jack up albinos like no eyes short bottom jaws the works.
    Quote Originally Posted by kc261 View Post
    I remember seeing a video of a really messed up clutch that Ralph produced. May be misremembering, but I thought it was a morph he was trying to prove out, and kept having issues.

    If it was an already proven morph, and he was just trying to make a combo, that does lean more in the direction of an inbreeding issue than just an issue with the morph itself.
    It was the granite albino. He was trying to get offspring that look like the mother by breeding her sons back to her. He had done it twice IIRC and got train wrecks both times. He says in the breeding records page on it that line breeding probably will not work for that project.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    kc261 (06-19-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1