» Site Navigation
0 members and 633 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,190
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
BPnet Veteran
Re: Woma hidden gene
 Originally Posted by mainbutter
not entirely true.
homozygous mojaves have greyed heads.
phantom-lessers make white snakes(I believe), but super phantoms have distinct coloration and patterning to them.
I'm not 100% up to par on the history of the "special"(another BEL complex gene), but from what I understand the special-mojo combo makes the "crystal", which is definitely not an all white snake.
butters and lessers are what people typically think of when they think of "BEL complex", and the homozygous forms are pretty much all white snakes with blue eyes, but there is so much more to the BEL complex than butters and lessers.
I stand corrected. Thank you. So maybe it is a Special or something...
-
-
Re: Woma hidden gene
Well I found it:
http://ball-pythons.net/forums/showt...ht=hidden+gene
Starts getting into the nitty-gritty on page 2
 Originally Posted by LGL
That would make sense because if the hidden gene was part of the BEL complex, then a Woma Hidden-Gene Lesser combo (Soul Sucker) would, in theory, produce a BEL... A snake with two allels of the BEL complex produces a white snake. (in this case Lesser and Hidden-Gene, if the Hidden Gene was a part of the complex).
Hmmmm......
Not totally true. The Phantom is a member of the BluEL group yet SuperPhantom is not a white snake... And consensus is that RDRs "daddy" gene is part of the BluEL group as well but we have yet to see a super form of that despite reports of RDR breeding "hets" for "daddy" for some years...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Woma hidden gene
 Originally Posted by jnjreptiles
There is actually only 1 line of woma, it is believed that the origional woma was bred to a special female and those babies are the ones with the "special" gene.
Womas on their own do not have the special gene, and the ones with the gene seem to look pretty normal as the gene is a suttle one.
Uh...no. There's more than one line of Womas, and the "hidden" gene carriers have nothing to do with a separate "special female."
Per Kev. You know, pillow talk & what not. 
K~
-
The Following 4 Users Say Thank You to Kara For This Useful Post:
dr del (06-19-2009),rabernet (06-18-2009),Spaniard (06-18-2009),waltah! (06-18-2009)
-
Re: Woma hidden gene
 Originally Posted by KLG
Uh...no. There's more than one line of Womas, and the "hidden" gene carriers have nothing to do with a separate "special female."
Per Kev. You know, pillow talk & what not.
K~
Then what exactly is the hidden gene? Is it an actual separate gene that has nothing to do with the woma mutation but works to modify it? Or are there two different womalike mutations?
You got a talking pillow? Cool.
Draco dormiens nunquam titillandus
-
The Following User Says Thank You to MarkS For This Useful Post:
-
Re: Woma hidden gene
 Originally Posted by MarkS
Then what exactly is the hidden gene? Is it an actual separate gene that has nothing to do with the woma mutation but works to modify it? Or are there two different womalike mutations?
You got a talking pillow? Cool. 
Dood...I will poke Kev w/a stick & get him to come talk about it. All Womas are not created equal, I can say that much. The rest is just blood pythons to me. Balls are fun to play with and drool over. 
And yeah, my talkin' pillow rawks my socks! Now if I could just train it to flip to the cool side on its own... 
K~
-
The Following 2 Users Say Thank You to Kara For This Useful Post:
dr del (06-19-2009),MarkS (06-18-2009)
-
Re: Woma hidden gene
 Originally Posted by KLG
Dood...I will poke Kev w/a stick & get him to come talk about it.
Oh good. I hope Kevin will come discuss it. I got excited when I saw you had replied to this thread, then slightly disappointed when your response didn't really answer many of the questions.
-
-
Re: Woma hidden gene
 Originally Posted by kc261
Oh good. I hope Kevin will come discuss it. I got excited when I saw you had replied to this thread, then slightly disappointed when your response didn't really answer many of the questions.
Oh, well...sorry about that. Again, ball pythons aren't really my thing. Hang tight, he'll be here to clarify....
K~
-
-
Re: Woma hidden gene
Oh, well...sorry about that. Again, ball pythons aren't really my thing. Hang tight, he'll be here to clarify.... [
K~[/QUOTE]
yeah yeah yeah....I'll believe it when I see it! Wait, are we talking about Kevin or the talking pillow....i'm so confused!
Last edited by waltah!; 06-18-2009 at 11:53 PM.
--Walt
-
-
Re: Woma hidden gene
 Originally Posted by KLG
Oh, well...sorry about that.  Again, ball pythons aren't really my thing. Hang tight, he'll be here to clarify....
K~
No problem! After your first post, I assumed you were just keeping the mystery mysterious.
-
-
Re: Woma hidden gene
 Originally Posted by KLG
Dood...I will poke Kev w/a stick & get him to come talk about it.
Please, please do. I would love a chance to pick his brain
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|