» Site Navigation
0 members and 1,028 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,067
Threads: 249,217
Posts: 2,572,782
Top Poster: JLC (31,651)
|
-
Registered User
What is a jag sib?
this has to do with carpets, what's a jag sib?
-
-
Registered User
Re: What is a jag sib?
this is just a guess, i'm not way into carpets....
jaguar *i think* is recessive, jag sibs are hets for jag. apparently many jags and jag sibs have built in nuero issues, such as the jag sib i have. at first glance, mine seems to be in death throes, but he eats vigorously, just has a hard time with coordination and body control.
why are you asking?
-
-
Re: What is a jag sib?
this question was already answered in the other thread you started!!!
http://www.ball-pythons.net/forums/s...ad.php?t=92279
-
-
Re: What is a jag sib?
 Originally Posted by Ben Biscy
this is just a guess, i'm not way into carpets....
jaguar *i think* is recessive, jag sibs are hets for jag. apparently many jags and jag sibs have built in nuero issues, such as the jag sib i have. at first glance, mine seems to be in death throes, but he eats vigorously, just has a hard time with coordination and body control.
why are you asking?
The Jaguar is a co-dom
-
-
BPnet Veteran
Re: What is a jag sib?
 Originally Posted by Ben Biscy
this is just a guess, i'm not way into carpets....
jaguar *i think* is recessive, jag sibs are hets for jag. apparently many jags and jag sibs have built in nuero issues, such as the jag sib i have. at first glance, mine seems to be in death throes, but he eats vigorously, just has a hard time with coordination and body control.
why are you asking?
The jag gene is a co-dom. The jag sib just refers to a normal in the clutch that does not carry the jaguar gene. Kind of like pastel ball sibs.
At one time, there was a belief that there was some magic in the sibs but has since been debunked.
And by the way, the sibs do not have neuro issues. I have no idea where you are getting your info.
-
-
Registered User
Re: What is a jag sib?
 Originally Posted by MPenn
The jag gene is a co-dom. The jag sib just refers to a normal in the clutch that does not carry the jaguar gene. Kind of like pastel ball sibs.
At one time, there was a belief that there was some magic in the sibs but has since been debunked.
And by the way, the sibs do not have neuro issues. I have no idea where you are getting your info.
explain this one. he's eating fine, growing well, in shed right now. eating small mice weekly. stress him out and this is what you get....
YouTube - jungle carpet is sick
if that's not a nuero issue i don't know what is. however, i have minimal experience with carpets, i've never raised or collected them until this one, and i haven't gotten any more BECAUSE of this one. i saw another video of a breeder who had a jag with pretty severe nuero issues when stressed, in the video he showed it combating with another male, flipping upside down, over reaching, etc. basically just like mine, but adult instead of baby.
i get my info from drawing conclusions based on the things i see and the information i'm exposed to. two and two usually ends up being four.
-
-
BPnet Veteran
Re: What is a jag sib?
what michael meant was that they do not have any genetically passed expressed neurological conditions. any snake can act like that if you drop them, expose them to high heat, chemicals, etc... or if they're just born with a defect.
it has nothing to do with the jag gene... they're just normal carpets.
Colin Vestrand
long time keeper and breeder of carpet pythons and other snakes...
-
The Following User Says Thank You to Colin Vestrand For This Useful Post:
-
Re: What is a jag sib?
 Originally Posted by Colin Vestrand
what michael meant was that they do not have any genetically passed expressed neurological conditions. any snake can act like that if you drop them, expose them to high heat, chemicals, etc... or if they're just born with a defect.
it has nothing to do with the jag gene... they're just normal carpets.
If that is the case then why do so many jags seem to have this "tick" while relatively few normals have it? What are so many jag owners doing wrong to induce the condition that normal owners are not doing? And why, when jags cost $1-5k a few years ago, were serious keepers doing anything with such expensive animals that might put their animals at risk?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: What is a jag sib?
 Originally Posted by asplundii
If that is the case then why do so many jags seem to have this "tick" while relatively few normals have it? What are so many jag owners doing wrong to induce the condition that normal owners are not doing? And why, when jags cost $1-5k a few years ago, were serious keepers doing anything with such expensive animals that might put their animals at risk?
No one is for sure why the jags have this "tick". It is believed to be similar to the spider ball. Both have a lethal super and the het (ie. jag and spider) is a carrier.
I will add that not all jags exhibit this behavior. It has been concluded that it can be brought on by stress (ie. chemicals, high heat, combatting).
I am not sure where you think that jag owners are doing something intentionally to produce bobble-head jags. Read above.
-
-
BPnet Veteran
Re: What is a jag sib?
 Originally Posted by asplundii
If that is the case then why do so many jags seem to have this "tick" while relatively few normals have it? What are so many jag owners doing wrong to induce the condition that normal owners are not doing? And why, when jags cost $1-5k a few years ago, were serious keepers doing anything with such expensive animals that might put their animals at risk?
i only meant it was not genetic as far as the jag SIBS go... i should have been more clear. i agree that jags, themselves, have issues.
Colin Vestrand
long time keeper and breeder of carpet pythons and other snakes...
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|