Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 553

0 members and 553 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Search Forums

» Today's Birthdays

None

» Stats

Members: 76,067
Threads: 249,217
Posts: 2,572,780
Top Poster: JLC (31,651)
Welcome to our newest member, Inky Clouds
Results 1 to 5 of 5

Thread: Random question

Threaded View

  1. 06-11-2009, 09:11 AM #2
    asplundii
    asplundii is offline
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Random question

    Mine was just shy of 1m at a year old
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
    Reply With Quote Reply With Quote

  2. The Following User Says Thank You to asplundii For This Useful Post:

    zackw419 (06-11-2009)
« Previous Thread | Next Thread »

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  

Forum Rules
Powered by vBadvanced CMPS v4.2.1