» Site Navigation
0 members and 2,321 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,162
Threads: 248,599
Posts: 2,569,145
Top Poster: JLC (31,651)
Welcome to our newest member, Csr112
|
-
BPnet Veteran
New Ordinance passed lastnight in my city!!!!
A new city ordinance was passed lastnight for all exotic animals!! Snakes cannot be over 4 1/2 ft, lizards can't be over 10 lbs and birds over 5 lbs!!! If your caught it is a 50-300 dollar fine! They said though that they will not be actively seeking these pets but if reported they will investigate and issue fines if necessary! What A Bummer for me who has 7 bp's!! But good nes is I don't live in the city! I live on the outskirts of the city but still in the same county so i have to see if it applies to me too! So wish me luck!! On a brighter note my wife and I are about to buy our first house and will be looking to get one in the country so I can do whatever I want and have as many BIG snakes as I can fit and properly take care of! LOL
-
-
Re: New Ordinance passed lastnight in my city!!!!
that sucks!! well when you get your house, make a super secret spinning door that hides behind a bookshelf that goes into a cave that leads into the snake room....
-
-
Re: New Ordinance passed lastnight in my city!!!!
As if living in a city named Lebanon isn't bad enough. Hopefully it doesn't apply to you living outside of city limits.
Also, maybe it's not too late to voice your opinion at the next city council meeting.
Good luck!
-Lawrence
-
-
BPnet Veteran
Re: New Ordinance passed lastnight in my city!!!!
Oh crap.. that sux and I wonder if its going to head my way. I'm in bushkill pa. Now to search for laws. good luck with the house purchasing and moving. Hopefully you can "escape" with your snakes to a county that hasn't passed anything yet.
-
-
Re: New Ordinance passed lastnight in my city!!!!
Originally Posted by BLong7211
But good nes is I don't live in the city! I live on the outskirts of the city but still in the same county so i have to see if it applies to me too! So wish me luck!!
My advice to you is to not even bother asking questions cause it will draw attention to you.
I had an acquaintance who learned that a certain species of kingsnake was not legal to own where he lived. He had a pet store king, bought while living in a different state, that looked similar to the local species but was indeed not the local species. He emailed the authorities with pics and the background of the animal to make sure he was above the board. The reply he got back was that, because his animal looked like the species in question it was illegal for him to own. And 2 days later he had F&W knocking on his door.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
BPnet Veteran
Re: New Ordinance passed lastnight in my city!!!!
Originally Posted by Lucas339
that sucks!! well when you get your house, make a super secret spinning door that hides behind a bookshelf that goes into a cave that leads into the snake room....
LOL! Just like the secret annex in The Diary of Anne Frank.
-
-
BPnet Veteran
Re: New Ordinance passed lastnight in my city!!!!
Just found out they are trying to do the same in my city, banning any non-indigenous reptile exluding turtles and tortoise
-
-
BPnet Veteran
Re: New Ordinance passed lastnight in my city!!!!
that sucks. My city has a 6 foot law on snakes that isn't enforced, even though all pet shops around here sell red tails and some retics and burms
-
-
BPnet Veteran
Re: New Ordinance passed lastnight in my city!!!!
Originally Posted by Lucas339
that sucks!! well when you get your house, make a super secret spinning door that hides behind a bookshelf that goes into a cave that leads into the snake room....
I want that in my house. Now.
Imagine if you had bats living in the cave and then a huge iron door at the end with a wheel you had to turn to open it. Okay now I'm excited. When I become a millionaire I'm going to do it.
-
-
BPnet Veteran
Re: New Ordinance passed lastnight in my city!!!!
4 1/2 feet!!! Where did they pull that number out of? That doesn't seem based on any facts. I have a corn snake who will be longer than that shortly. Oh no! She's soooo scary! LOL!
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|