» Site Navigation
2 members and 677 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
BPnet Veteran
Has it been created
A super axanthic cinny ball python
-
-
Re: Has it been created
Can you get a super form out of a recessive gene? Or do you mean a super cinnamon axanthic?
"Be not afraid of greatness: some are born great, some achieve greatness, and some have greatness thrust upon them." ~William Shakespeare
1.1 Normals - Apollo & Medusa
1.0 Pastel - Zeke
0.1 Pastel het OG - Dixie
0.1 Pastel het Axanthic
0.1 Spider het Axanthic
1.1 Mojave - Clyde & Bonnie
1.0 Black Pastel - Conan
0.1 Spider - Dizzy
-
-
BPnet Veteran
Re: Has it been created
like if paired up two cinny axanthic's up would it create a super form Maybe a all grey snake
-
-
Re: Has it been created
Okay, what you are asking about is the Axanthic Super Cinny, and I actually doubt that it would be a grey snake. There is very little yellow in the Super, so it wouldn't change much in terms of color.
And no, it has not been done.
-
-
Re: Has it been created
 Originally Posted by B@LLZ4LIFE
like if paired up two cinny axanthic's up would it create a super form Maybe a all grey snake
cinny axanthinc x cinny axanthinc would have the potential to create a super cinny and/or a super cinny axanthic which would both look like an all black snake. It would not be all grey.
For a solid grey snake you would be wanting a super pastel super cinny/black pastel
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Has it been created
 Originally Posted by asplundii
cinny axanthinc x cinny axanthinc would have the potential to create a super cinny and/or a super cinny axanthic which would both look like an all black snake. It would not be all grey.
For a solid grey snake you would be wanting a super pastel super cinny/black pastel
Actually A Cinny Axanthic x Cinny Axanthic has no chance at all of producing a plain Super Cinny. Everything in the clutch would be Axanthic at minimum. Leaving the possibilities at Axanthic, Axanthic Cinny and Axanthic Super Cinny.
As everyone else stated, the lack of yellows in the Super Cinny, doesn't leave much for the Axanthic gene to work on. In my opinion, if anything, it will make the Super Cinny a slightly blacker animal, and it should fade to brown a bit less as it ages.
-
-
Re: Has it been created
 Originally Posted by muddoc
Actually A Cinny Axanthic x Cinny Axanthic has no chance at all of producing a plain Super Cinny.
Yes you are right. My brain must have been on vacation when I typed that as I was thinking het axanthinc... My bad
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Has it been created
BALLS4LIFE who knows what the hell that makes ! but maybe you should try it ! and stuff what all of these KNOW IT ALL "OOH ITS GUNNA BE A SLIGHTLY DIFF BLAHA BLAAH ... JUST TRY IT SOME OF THE BEST LOOKING MORPHS WHERE CREATED BY PEOPLE LIKE YOU SO DONT LISTEN TO ANYONES opinion ...
Last edited by dr del; 05-06-2009 at 04:54 PM.
Reason: replacing censored words with italicised alternatives
-
-
Re: Has it been created
 Originally Posted by Anarchy
BALLS4LIFE who knows what the hell that makes ! but maybe you should try it ! and stuff what all of these KNOW IT ALL "OOH ITS GUNNA BE A SLIGHTLY DIFF BLAHA BLAAH ... JUST TRY IT SOME OF THE BEST LOOKING MORPHS WHERE CREATED BY PEOPLE LIKE YOU SO DONT LISTEN TO ANYONES opinion ... 
You crack me up! I agree. just try it. If it's never been done, who knows?
Last edited by dr del; 05-06-2009 at 04:55 PM.
Reason: matching quote to edited post
"Be not afraid of greatness: some are born great, some achieve greatness, and some have greatness thrust upon them." ~William Shakespeare
1.1 Normals - Apollo & Medusa
1.0 Pastel - Zeke
0.1 Pastel het OG - Dixie
0.1 Pastel het Axanthic
0.1 Spider het Axanthic
1.1 Mojave - Clyde & Bonnie
1.0 Black Pastel - Conan
0.1 Spider - Dizzy
-
The Following User Says Thank You to stratus_020202 For This Useful Post:
-
Re: Has it been created
I agree that if one is curious what a potential combo would look like, the best way to find out is to make it rather than asking on a forum (unless it has already been made). However, it takes rather a long time, and isn't necessarily very practical.
In some cases, we have no idea why a morph creates the look it does, and it is very hard to predict what a combo will look like.
In the case of the axanthic genes, we know pretty much exactly what they do, so it is much easier to predict what an axanthic combo will look like. Specifically, the axanthic gene reduces (pretty much eliminates) the production or expression of the yellow pigment cells, which I believe are called xanthospores. So, in a snake that already shows very little yellow, reducing or eliminating it should have very little effect.
That is not to say it is impossible that there will be an unexpected outcome, just highly unlikely. It is even possible that one of the 3 known axanthic genes would create an interesting effect, while the other 2 behave in the way we expect in this combo. So go ahead and make all 3 versions of it if you want. Personally, I'd rather use my breeding efforts in a direction likely to make something a little more interesting than an axanthic super cinnamon that may be indistinguishable from a regular super cinnamon.
Last edited by kc261; 05-06-2009 at 07:12 PM.
Reason: hit submit too soon
Casey
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|