Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 949

0 members and 949 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,141
Posts: 2,572,335
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Page 4 of 6 FirstFirst 123456 LastLast
Results 31 to 40 of 58

Thread: Swine Flu

  1. #31
    BPnet Veteran Serpents_Den's Avatar
    Join Date
    05-10-2004
    Location
    Pennsylvania
    Posts
    846
    Thanks
    578
    Thanked 369 Times in 198 Posts
    Images: 1

    Re: Swine Flu

    www.HealthFreedomUSA.org
    http://www.healthfreedomusa.org/?page_id=195


    "Pandemic panic" is not necessary.

    Forced vaccinations, transportation and public event closings, and martial law are not necessary!


    **Deaths in Mexico have gone FROM 168 TO 16. Now that is REAL healing! WHERE ARE THE HUNDREDS OF DEATHS THE MMD (media of mass deception) WERE ORIGINALLY REPORTING?

    **CDC said that we should expect to see more severe cases of the Swine Flu on April 26, despite the fact that NONE OF THE CASES THEY HAVE IDENTIFIED ARE AT ALL SEVERE.

    **WHO raised the alert level to Phase 5, the start of a Pandemic, on April 29 with one alleged death and only 91 confirmed human cases of a MILD, INCONSEQUENTIAL FLU, with one death.

    **WHO changed the name of the current "Pandemic" from "Swine Flu" to "H1N1Influenza", because the name would "CAUSE AN UNWARRANTED CLAMPDOWN ON PORK TRADE"

    **Hawaii's Governor, Linda Lingle, said that WHO was considering raising the alert status of the "Pandemic" to Level 6 on May 1, DESPITE THE LACK OF ANY MEANINGFUL THREAT.

    **Saving the Best for Last. I wonder at the total absurdity of the following article: "And now, Canada officials say pigs have been infected and are under quarantine. IT'S THE FIRST KNOWN CASE OF PIGS HAVING THE VIRUS." http://www.wytv.com/content/news/loc...mGGGHlnhg.cspx


    WHILE ALL THIS IS GOING ON, are you thinking about the insanity and criminality of the bailout? Of the weaponization and industrialization of all food production and control? Of the rapid coming of the new global currency? Of the dissolution of national states under the emergency authority of the United Nations, to whom all power is ceded under a state of "Global Pandemic"?

    This is the ultimate slight of hand. But instead of a rabbit magically pulled out of the hat, it is a weaponized vaccine in a syringe. The syringe of death. Death to health, freedom and, very possibly, billions of people.

    IF PEOPLE RESIST, RIOT OR PROTEST? MARSHAL LAW IS RIGHT AROUND THE CORNER.

    See my blog posting about the Psychology and Physiology of Change: The Brainwashing of the West - http://www.healthfreedomusa.org/?p=1940

    Dr. Leonard Horowitz, in an astounding YouTube presentation, names the names of the researchers, institutes and companies he considers responsible.

    YouTube - Mexican Flu Outbreak 2009: SPECIAL REPORT by Dr Leonard Horowitz

  2. #32
    Registered User grim reaper in NY's Avatar
    Join Date
    04-04-2009
    Location
    Upstate New York
    Posts
    371
    Thanks
    56
    Thanked 86 Times in 54 Posts

    Re: Swine Flu

    This strain of flu is really no worse than any other acute strain. People die from the flu in the United States every single year. You don't hear about it though because it's not sensational news. This story was sensational because it was traced to a foreign country and the media hyped it up to make it sound worse than it really was.
    I work in an Emergency Department and the people we've been flooded with watch way too much television and take too much to heart. The same things apply to this strain that applies to every other acute strain. You will have a harder time fighting it if you have a deficient immune system, are elderly, or are currently afflicted with another ailment that is wearing the body down. Infants and toddlers are also more suseptible simply because their immune systems aren't as developed as a healthy adult's is.
    I'm all for freedom of the press, but this exposure was totally inappropriate and uncalled for and served no good to anyone. All it did was create a panic that could have easily been avoided. Of course countries like Mexico are going to see more deaths from viruses like this. In countries where healthcare is not as developed as ours, or where the country's citizens don't have the access to health care, you will see increased deaths and afflicted citizens. People just need to keep this stuff in mind when the media tries to make a mountain out of a mole hill.
    Later,

    Bri


    0.1 - Pastel Ball Python
    2.0 - Normal Ball Pythons

  3. #33
    BPnet Veteran
    Join Date
    09-24-2007
    Posts
    995
    Thanks
    0
    Thanked 93 Times in 76 Posts

    Re: Swine Flu

    None of us would be here today if not for viruses. Their role on our planet is to ensure our survival. Had they not taken the old and the weak since the dawn of time we could not have survived as a species. We are all the result of selective breeding and viruses are our keepers. The only reason they keep trying to find new ways to kill us is because we keep fighting them.

  4. #34
    Apprentice SPAM Janitor MarkS's Avatar
    Join Date
    07-22-2005
    Location
    St Paul, MN
    Posts
    6,209
    Thanks
    1,535
    Thanked 2,678 Times in 1,596 Posts
    Blog Entries
    9
    Images: 3

    Re: Swine Flu

    Quote Originally Posted by Serpents_Den View Post
    www.HealthFreedomUSA.org
    http://www.healthfreedomusa.org/?page_id=195


    "Pandemic panic" is not necessary.

    Forced vaccinations, transportation and public event closings, and martial law are not necessary!


    **Deaths in Mexico have gone FROM 168 TO 16. Now that is REAL healing! WHERE ARE THE HUNDREDS OF DEATHS THE MMD (media of mass deception) WERE ORIGINALLY REPORTING?

    **CDC said that we should expect to see more severe cases of the Swine Flu on April 26, despite the fact that NONE OF THE CASES THEY HAVE IDENTIFIED ARE AT ALL SEVERE.

    **WHO raised the alert level to Phase 5, the start of a Pandemic, on April 29 with one alleged death and only 91 confirmed human cases of a MILD, INCONSEQUENTIAL FLU, with one death.

    **WHO changed the name of the current "Pandemic" from "Swine Flu" to "H1N1Influenza", because the name would "CAUSE AN UNWARRANTED CLAMPDOWN ON PORK TRADE"

    **Hawaii's Governor, Linda Lingle, said that WHO was considering raising the alert status of the "Pandemic" to Level 6 on May 1, DESPITE THE LACK OF ANY MEANINGFUL THREAT.

    **Saving the Best for Last. I wonder at the total absurdity of the following article: "And now, Canada officials say pigs have been infected and are under quarantine. IT'S THE FIRST KNOWN CASE OF PIGS HAVING THE VIRUS." http://www.wytv.com/content/news/loc...mGGGHlnhg.cspx


    WHILE ALL THIS IS GOING ON, are you thinking about the insanity and criminality of the bailout? Of the weaponization and industrialization of all food production and control? Of the rapid coming of the new global currency? Of the dissolution of national states under the emergency authority of the United Nations, to whom all power is ceded under a state of "Global Pandemic"?

    This is the ultimate slight of hand. But instead of a rabbit magically pulled out of the hat, it is a weaponized vaccine in a syringe. The syringe of death. Death to health, freedom and, very possibly, billions of people.

    IF PEOPLE RESIST, RIOT OR PROTEST? MARSHAL LAW IS RIGHT AROUND THE CORNER.

    See my blog posting about the Psychology and Physiology of Change: The Brainwashing of the West - http://www.healthfreedomusa.org/?p=1940
    I was wondering where all the nutjob bloggers had disappeared to after the election.
    Draco dormiens nunquam titillandus

  5. #35
    BPnet Veteran FIREball's Avatar
    Join Date
    08-21-2007
    Location
    Florida
    Posts
    1,190
    Thanks
    205
    Thanked 131 Times in 109 Posts

    Re: Swine Flu

    I think this is no different than regular flu, just a new strain.

    A LOT of people die from the flu each year, but since this is "the new thing" its getting a lot of media attention.

    Too much hype, I woudn't worry more about this than the common flu.

  6. #36
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Swine Flu

    Quote Originally Posted by MarkS View Post
    I was wondering where all the nutjob bloggers had disappeared to after the election.
    You beat me to saying it Mark LOL

    If I were really bored I would post the last weeks worth of ProMed Digests on the topic to provide him with a proper education on all that went on. But I know when my arguments would fall on deaf ears and he would just see those as further deceptions by the evil overlords...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #37
    BPnet Veteran Egapal's Avatar
    Join Date
    09-28-2008
    Location
    Upstate New York
    Posts
    689
    Thanks
    59
    Thanked 213 Times in 138 Posts
    Images: 8

    Re: Swine Flu

    The problem is that the scientific community is worried for good reason. Cross species diseases can be particularly dangerous. They have proven how good they are at mutating and in some cases humans have limited or no immunity. So I am all for government and science getting ready but then the news gets involved and people panic. The public knowing everything is not always a good thing.

    I also totally agree with the sentiment that has been mentioned in this thread many times. Tens of thousands of death certificates every year have FLU written on them.

  8. #38
    Registered User
    Join Date
    01-30-2009
    Location
    St.Catharines,Ontario
    Posts
    395
    Thanks
    2
    Thanked 20 Times in 20 Posts

    Re: Swine Flu

    This is not about now it's about in the future. It's a hybrid virus so animals can get it pass it on back to people and evalution will make it more of a risk. Please watch this movie it'll tell you why we need to worry about this virus.
    YouTube - Why we have virus outbreaks & how we can prevent them
    Too many pets to list!

  9. #39
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Swine Flu

    Quote Originally Posted by rebeccabecca View Post
    This is not about now it's about in the future. It's a hybrid virus so animals can get it pass it on back to people and evalution will make it more of a risk. Please watch this movie it'll tell you why we need to worry about this virus.
    This H1N1 flu virus is no more or less a hybrid that any of the flu viruses out there. Do even minimal research into the background of flu as a virus and you would know that. And what is being discussed in that clip is not in any way related to the current flu hysteria

    That movie is no more accurate than all the hype that has been put out by the mainstream news media outlets. It is overly dumbed down to reach the "average Joe" who hasn't got a whit of scientific knowledge and it has lost its message along the way. Notice that despite all his big talk and hand waving he did not really say all that much and he did not produce a shred of real evidence on the things he says he discovered (not that I am discounting them mind you, but once you learn to think like a scientist it is not something you drop) nor does he show in any way that the few cases he found were anything more than 'one of' situations. Do diseases pass between species? Yes, all the bloody time. Does that mean each time it is going to erupt into the next great plague? Not in the slightest. Diseases tend to be very host specific and when they make the jump 99.999% of the time it is a dead end jump because the new host is not a fit environment for the disease. So, will we keep seeing new and scary things pooping up in the future? Absolutely. But am I worried about Ebola becoming the next pandemic plague? Nope.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #40
    BPnet Veteran Serpents_Den's Avatar
    Join Date
    05-10-2004
    Location
    Pennsylvania
    Posts
    846
    Thanks
    578
    Thanked 369 Times in 198 Posts
    Images: 1

    Re: Swine Flu

    To many of you speculate without doing any research. If your only source for information is assuming or from corporate government owned media than you can see why this country has gone to hell.

    George Carlin RIP

    **video removed as inappropriate**
    Last edited by dr del; 05-06-2009 at 04:38 PM. Reason: Extremely non family-friendly language in the video

Page 4 of 6 FirstFirst 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1