Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 598

0 members and 598 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,112
Posts: 2,572,158
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 10 of 58

Thread: Swine Flu

Threaded View

  1. #27
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Swine Flu

    Quote Originally Posted by Jyson View Post
    Wasn't they dealing with the spanish flu in 1918? I think was one the one that took thousands of lives (in europe) but perhaps that one crossed over to America?
    Yes the "Spanish" Flu was 1918/19 but it was a global pandemic that circled the globe no less than 3 times hitting every continent. And significantly more than a few thousand people died.

    Quote Originally Posted by Mike Cavanaugh View Post
    What puzzles me about it is the deaths in mexico compared to the lesser effect in the United States. I have read several articles that point out how obviously the US has better healthcare, but I haven't found anyone yet that says better healthcare is the the reason they are dying over there, and just getting sick here. Most articles flat out say they don't know why it is ending in death in Mexico.
    I would say health care is a pretty big sticking point. If you do not have the infrastructure and the supplies to support those that are ill then they are going to suffer more compared to those that do have the infrastructure.

    There is also another factor that may be contributing to a higher level of "pre-immunity" here but I'll not bog people down in the details of that because I am sure that the majority of you do not care

    I am no scientific guru by any means, so my uneducated common sense tells me that maybe there are two different strains of the virus.... the one that it killing people in Mexico, and the weaker one that is just making people sick here.
    It is all one strain, they have typed it already so they know that the cases in Mexico are caused by the same strain as the cases here and in Europe and in Aus/NZ.

    Anyways, can someone please tell me why we aren't tightening up our borders until we have this whole thing figured out?!
    We are actually

    Quote Originally Posted by Mike Cavanaugh View Post
    At a time when Obama will be criticized for every penny spent, him asking for 1.5 billion to fight swine flu shows me it is something the administration (who knows way more then any of us) is taking it VERY seriously.
    There is a bit of a fallacy in that logic. Huge amounts of money were thrown into the "avian" flu which has gone all of nowhere in terms of being the next great lethal pandemic. This is part of the hype, people get scared cause the media starts throwing out questionable "facts" and then the public wants the scientists to save to world. And the scientists are not going to say no to "free" money to do more research.

    Quote Originally Posted by MarkS View Post
    According to the CDC, about 36 THOUSAND people in the U.S. die ANNUALLY from flu related causes.

    So, how is this so different from every other year?
    Quote Originally Posted by Mike Cavanaugh View Post
    Yep, ONLY 36 ThOUSAND people die anually from flu related causes because a large number of people, who are particularly vulnerable, get a FLU SHOT... Something that is not available for this flu, and wont be for months.
    And flu season is about to end here at which this flu will go to ground for the season and they will use the summer to make next year's flu vaccine (like they always do) and one component in that vaccine will be against this strain so that when flu season begins again, when/if this strain comes back, the vaccine will confer protection against it.

    Mark is correct to ask how this is different than any other year. There is a good chance it is not any different. It is just that a strain that was not covered by this past years vaccine is popping up at the end of the season so no one has any type of exposure to it. This happens all the time, it just does not always happen in a place where the infrastructure allows for a rapid explosion of cases like this one did.


    At the end of the day it is still too early to say what exactly will happen with this. The best thing to do is just be prudent, wash you hands, don't cough on your neighbors and not buy into the hype.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Beardedragon (05-03-2009),Jyson (05-07-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1