Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,497

1 members and 1,496 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,073
Threads: 249,220
Posts: 2,572,808
Top Poster: JLC (31,651)
Welcome to our newest member, LeonoraOrdonez5
Results 1 to 10 of 21

Threaded View

  1. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: what is het Russo & white diamond?

    Yeah they are one of the BluEL group. The lucie is the White Diamond. the het Russo is, well, the het form...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    t-Roy (04-03-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1