Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 555

0 members and 555 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,069
Threads: 249,219
Posts: 2,572,797
Top Poster: JLC (31,651)
Welcome to our newest member, ColorblindChameleon
Page 3 of 5 FirstFirst 12345 LastLast
Results 21 to 30 of 42
  1. #21
    Registered User
    Join Date
    03-30-2009
    Posts
    423
    Thanks
    157
    Thanked 43 Times in 41 Posts

    Re: Jungle Carpet Python Help

    Isn't it ironic how the most expensive specimen we picked up is the one with the problems? lol, go figure.

    The little guy is sleeping now, coiled up in his hide. I can't see his eyes, and i don't want to stress him out anymore (minimal to no activity until feeding day, we'll see what happens). I think that the best bet here is if the animal does not eat in two weeks, and/or if the condition worsens I'll euthenize it myself. I don't have grand breeding plans, but i'm one to believe that bad genes SHOULD be eliminated. If he does feed, and just has a stress wobble, he should still make a very nice display animal (i don't handle my animals as often as most).

    Also, I got this guy from the herp show in Columbia. These guys had VERY nice animals, I also bought two kenyans from them (which JUST shed are are doing GREAT!). I personally do not thing it's ibd either, as I did some reading and comparing, and the symptoms don't quite match.

    Thanks again everyone!

  2. #22
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Jungle Carpet Python Help

    Hey Ben,

    I brought up the eyes because, as a number of people have mentioned, this does look a bit like an extremem case of the Jag neuro issue. It is hard to tell from the pics if your animal is a heavy patterend Jag though. The eyes help with an ID because Jags, for the most, have a silver/blue/pale eye compared to the dark eye of a normal. No need to bother the animal now to find out but next time it is out maybe take a gander.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #23
    BPnet Veteran Colin Vestrand's Avatar
    Join Date
    09-28-2005
    Location
    kalamazoo, mi
    Posts
    1,691
    Thanks
    32
    Thanked 162 Times in 127 Posts
    Images: 70

    Re: Jungle Carpet Python Help

    i don't think it looks like a 'jag related neuro issue' personally... if i had to guess i'd say it's some sort of damage brought on by illness and/or dehydration or, because it's young, it may have just been born with some chromosomal damage.

    i once had a carpet that got a mite infestation, followed by RI. the antibiotics were too much for him... the RI cleared up, but then he started acting exactly like what you're seeing here. he was fine until you touch him... then he'd do what yours does. it was sad because it was my first carpet... a true 'pet' snake.

    pick up the last third of his body? is it limp and loose compared to his tightly constricted upper 2/3? if so, then you have your answer.

    i'm not a vet, this is just my opinion... for what it's worth.

    bottom line, i'd be getting my money back!
    Last edited by Colin Vestrand; 04-03-2009 at 11:23 AM.
    Colin Vestrand

    long time keeper and breeder of carpet pythons and other snakes...

  4. The Following User Says Thank You to Colin Vestrand For This Useful Post:

    DutchHerp (04-03-2009)

  5. #24
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Jungle Carpet Python Help

    Quote Originally Posted by Colin Vestrand View Post
    i don't think it looks like a 'jag related neuro issue' personally...
    I was not saying it was necessarily a Jag neuro issue, just throwing out a possibility. I have never seen a true, worst case scenario train wreck Jag but from the few twitchy Jags I have seen and then extrapolating against the twitchy spiders I have seen vs. the train wreck spiders I have seen... This could be what a worst case Jag looks like... Maybe... But then again maybe not.

    If we knew if this was/was not a Jag though we could potentially shelf that whole line of thought. If it is a normal (i.e possible sib) then the idea of it being the neuro issue would be astronomically small.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #25
    BPnet Veteran DavidG's Avatar
    Join Date
    11-16-2008
    Location
    Alabama
    Posts
    644
    Thanks
    0
    Thanked 135 Times in 118 Posts

    Re: Jungle Carpet Python Help

    I think everything has already been said. If you do take it to a vet, which I recommend, tell him there is a chance of it having IBD. Even though, we don't think so, there is not a vet on board. If he has other reptiles in the facility it's not worth risking them.

  7. #26
    Registered User OuijaBoid's Avatar
    Join Date
    03-17-2009
    Location
    Raleigh, NC
    Posts
    39
    Thanks
    3
    Thanked 1 Time in 1 Post

    Re: Jungle Carpet Python Help

    You said he's in QT but in one of your first posts you stated that he's in your snake room? I would relocate him to another part of the house....just my .02...Ive seen this in an animal that was directly sprayed with mite spray in the past...back in the early 90's with something called "california spray"....Give him a nice luke warm soak...
    -George Blake
    OuijaBoid - Raleigh, NC

  8. #27
    BPnet Veteran Blizzarddude's Avatar
    Join Date
    08-04-2005
    Posts
    281
    Thanks
    28
    Thanked 30 Times in 25 Posts
    Images: 1

    Re: Jungle Carpet Python Help

    Hope you get this cleared up bud, hoping its something related to stress. As Ive said, it appears to be stress related due to the fact that he is fine until bothered.

    Good luck!
    - Bd

    "Law of the woods, eat or be eaten." - Jack London
    0.1 Adult normal - "Jemima" (Jem)
    1.0 Sub-adult spider - "Spidey"

  9. #28
    BPnet Veteran snakelady's Avatar
    Join Date
    01-19-2008
    Location
    near madison WI
    Posts
    989
    Thanks
    89
    Thanked 67 Times in 66 Posts
    Images: 2

    Re: Jungle Carpet Python Help

    The poor little guy!
    Also, that sucks...hearing about the jag problems. I love jags! crap!
    ~Tashai
    5.10 ball pythons, 1.1 hog island boas,
    1.1 mexican black kings, 0.1 jungle carpet python 0.1.3 crested geckos


    Visit my website: http://ti-imagery.com

  10. #29
    BPnet Veteran Colin Vestrand's Avatar
    Join Date
    09-28-2005
    Location
    kalamazoo, mi
    Posts
    1,691
    Thanks
    32
    Thanked 162 Times in 127 Posts
    Images: 70

    Re: Jungle Carpet Python Help

    Quote Originally Posted by snakelady View Post
    The poor little guy!
    Also, that sucks...hearing about the jag problems. I love jags! crap!
    don't let it scare you off... it's no worse than the problems you see with spiders. it's kind of an overstated issue in my opinion... they're still wonderful snakes and the vast majority don't have any recognizable differences to the average herper.
    Colin Vestrand

    long time keeper and breeder of carpet pythons and other snakes...

  11. #30
    Registered User
    Join Date
    01-09-2009
    Location
    Buffalo, NY
    Posts
    184
    Thanks
    25
    Thanked 17 Times in 16 Posts

    Re: Jungle Carpet Python Help

    Call up the breeder.. however if it does eat and it is just a little crazy in the head I would still keep him.

Page 3 of 5 FirstFirst 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1