0.1.0 Albino Jungle (Diva) 0.0.1 Leo Gecko(Loki) 1.0.0 Leo Gecko(Nova) 1.0.0 Spider Ball( Svita) 0.1.0 Pewter BP ( Cloud) 0.1.0 Het Orange Ghost ( Morgana) 1.0.0 Piebald ( Boo) 0.1.0 Piebald (Pandora) 0.1.0 88%IJ JAG( Halo) 1.0.0 Jungle Jag(Winter) 1.0.0. Clown ( Echo) 1.0.0 Albino Mojave ( Frost)
these guys are for sure on my list!! nice one!
Collection: http://www.iherp.com/Lucas339
Nice. Generics or locality animals? (that last looks a little like a Gap animal)
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Beautiful snakes. Again Size & Age? How long have you had them?
-Birds- 0.1 - Poicephalus senegalus - Stella (Senegal Parrot) 0.1- Poicephalus rufiventris - Alexa (Red-bellied Parrot) BP.net reviews Arachnoboards Reviews
Pretty GB, whats he eating?
Raul http://www.westcoastjungle.com/
They are both feeding on adult mice every 7 days.
are you planning on breeding them?
Forum Rules
Reply With Quote
