Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 715

2 members and 713 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,067
Threads: 249,217
Posts: 2,572,780
Top Poster: JLC (31,651)
Welcome to our newest member, Inky Clouds
Results 1 to 4 of 4

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What does 66% het mean?

    Quote Originally Posted by DeepSouthSerpents View Post
    Welcome (I would insert the smiley but WTH is wrong with them right now, did I miss something?)
    http://www.ballpython.ca/what_get/recessive.html
    The second row explains how you get 66% hets in a clutch when breeding a het x het. You actually only have 50% hets but since you cannot physically distinguish them from the normals, all of the ones appearing normal (whether or not they have the recessive gene) are considered 66% hets.

    Ummm... Actually you have 2 animals that are genetically het (or 100% het if you prefer that label) and one that is genetically normal. But all 3 are phenotypically normal. So if you were to pick an animal at random then there is a 66% chance that it will be genetically het.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Dave763 (04-01-2009),muddoc (04-01-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1