Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 670

0 members and 670 guests
No Members online
Most users ever online was 47,180, Yesterday at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,899
Threads: 249,095
Posts: 2,572,066
Top Poster: JLC (31,651)
Welcome to our newest member, HellboyBoa
Results 1 to 10 of 30

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Anaphylactic Shock?

    I am going to go out on a limb here and say your vet sounds like they do not know what they are doing. BPs go off feed all the time, they are notorious for it. And I would think any competent herp vet would know that... I also find it difficult to believe a BP would go into anaphylaxis over a dewormer. I am more inclined to think it was overdosed and what you were seeing was toxic effects and the vet pulled a CYA with the anaphylaxis excuse.

    There is no real need to deworm a CBB ball anyways...

    As for why your animal went off feed... As I said, they just do sometimes. I had an animal go off for 4 months. Then he started eating again like nothing had happened. I have heard of them going a year. So long as they are looking and acting healthy then just keep presenting with food on a regular basis. They will eat when they are ready
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Ed Chisholm (03-31-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1