Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,824

1 members and 1,823 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,098
Threads: 249,238
Posts: 2,572,918
Top Poster: JLC (31,651)
Welcome to our newest member, nightfallvt
Page 1 of 3 123 LastLast
Results 1 to 10 of 30
  1. #1
    Registered User Ed Chisholm's Avatar
    Join Date
    03-31-2009
    Location
    Fort Worth, Texas
    Posts
    60
    Thanks
    12
    Thanked 7 Times in 5 Posts
    Images: 3

    Anaphylactic Shock?

    My 3 year old female BP has not been interested in eating since Christmas. Up to this point she was feeding on F/T mice then rats, gradually getting them larger. She ate the last two "weanling" rats I had in one feeding in the first week of December. She ate one "small" rat a few days prior to Christmas Day, and since then has not eaten. Based on advice from my Vet I took her in for an exam. She was given a clean bill of health, he said she was a beautiful healthy snake. He did recommend de-worming medication as an annual treatment, so I allowed it. The next 10 hours were a nightmare. The medication sent her in to anaphylactic shock, something he said was VERY rare in Ball Phythons. She was placed on oxygen and given medication. She survived the ordeal (2 weeks ago), but is still not showing any signs of wanting to eat.

    I am now wanting to improve her second hiding space by enlarging the base of a "tree" in her enclosure.

    So here is my first question to anyone out there who has great knowledge in this area. What kind of wood should I avoid putting in her enclosure? I was thinking about a hardwood like maple for the base expansion, but I do not want to do anything that can possibly endanger her again.

    My second question is if anyone has any idea why she would suddenly stop eating? I have tried going back to the smaller rats (weanling), but she is not interested in those either.

  2. #2
    BPnet Veteran blackcrystal22's Avatar
    Join Date
    06-15-2008
    Location
    Geneva, Illinois, United States
    Posts
    4,059
    Thanks
    394
    Thanked 555 Times in 435 Posts
    Images: 6

    Re: Anaphylactic Shock?

    Quote Originally Posted by Ed Chisholm View Post
    My 3 year old female BP has not been interested in eating since Christmas. Up to this point she was feeding on F/T mice then rats, gradually getting them larger. She ate the last two "weanling" rats I had in one feeding in the first week of December. She ate one "small" rat a few days prior to Christmas Day, and since then has not eaten. Based on advice from my Vet I took her in for an exam. She was given a clean bill of health, he said she was a beautiful healthy snake. He did recommend de-worming medication as an annual treatment, so I allowed it. The next 10 hours were a nightmare. The medication sent her in to anaphylactic shock, something he said was VERY rare in Ball Phythons. She was placed on oxygen and given medication. She survived the ordeal (2 weeks ago), but is still not showing any signs of wanting to eat.

    I am now wanting to improve her second hiding space by enlarging the base of a "tree" in her enclosure.

    So here is my first question to anyone out there who has great knowledge in this area. What kind of wood should I avoid putting in her enclosure? I was thinking about a hardwood like maple for the base expansion, but I do not want to do anything that can possibly endanger her again.

    My second question is if anyone has any idea why she would suddenly stop eating? I have tried going back to the smaller rats (weanling), but she is not interested in those either.
    Your enclosure sounds a bit sketchy.. could you give us a rundown on her husbandry, temperatures, humidity, substrate, and pictures of the enclosure if possible?

  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Anaphylactic Shock?

    I am going to go out on a limb here and say your vet sounds like they do not know what they are doing. BPs go off feed all the time, they are notorious for it. And I would think any competent herp vet would know that... I also find it difficult to believe a BP would go into anaphylaxis over a dewormer. I am more inclined to think it was overdosed and what you were seeing was toxic effects and the vet pulled a CYA with the anaphylaxis excuse.

    There is no real need to deworm a CBB ball anyways...

    As for why your animal went off feed... As I said, they just do sometimes. I had an animal go off for 4 months. Then he started eating again like nothing had happened. I have heard of them going a year. So long as they are looking and acting healthy then just keep presenting with food on a regular basis. They will eat when they are ready
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following User Says Thank You to asplundii For This Useful Post:

    Ed Chisholm (03-31-2009)

  5. #4
    Registered User Ed Chisholm's Avatar
    Join Date
    03-31-2009
    Location
    Fort Worth, Texas
    Posts
    60
    Thanks
    12
    Thanked 7 Times in 5 Posts
    Images: 3

    Re: Anaphylactic Shock?

    She has a large enclosure with sliding front glass doors (purchased from a BP owner & Dealer). The enclosure measures about 36" Wide, 20" tall and 20" deep. The humidity remains in the 70 - 90% range. The temperature is regulated by a reostat adjusting an under the tank heater, so the floor can get upwards of 100 degrees, but the temperature 1/2 way up the enclosure is usually around 80 degrees. She has never been bred. Her substrate was "Jungle Bed" but I read that is was "okay" for ball Pythons, so I switched to substrate that was listed as "Perfect or ideal" for BP's. She has a 1/2 log hide area that is 1/2 on and 1/2 off the heated area of the floor, so she is on the heated area at times, and off of it at times. She has a large water dish, and piece of wood to climb (purchased from a BP dealer). The second hide area is a fake tree with a hollow base. She has grown too large to get all the way inside, o that is why I was expanding the base to create more room.

  6. #5
    BPnet Veteran
    Join Date
    09-24-2007
    Posts
    995
    Thanks
    0
    Thanked 93 Times in 76 Posts

    Re: Anaphylactic Shock?

    I would avoid anything porous in an enclosure. Just gives bad stuff a place to grow. And, nothing like live prey to break a fast.

  7. #6
    BPnet Veteran missi182's Avatar
    Join Date
    02-10-2008
    Location
    Ontario, Canada
    Posts
    1,389
    Thanks
    60
    Thanked 59 Times in 27 Posts
    Images: 28

    Re: Anaphylactic Shock?

    Why is your humidity so high? Are you using dials or digital gauges? Your hides should match 100% and be secure and snug - security is important to bps and often is the reason they go off feed.
    1.0 Normal Ball Python- Little Dude
    0.0.1 Albino Kingsnake - Weiner
    Missi

  8. #7
    BPnet Veteran nixer's Avatar
    Join Date
    03-28-2007
    Location
    indiana
    Posts
    2,827
    Thanks
    339
    Thanked 329 Times in 294 Posts
    Images: 3

    Re: Anaphylactic Shock?

    your vet doesnt know what he or she is doing! PERIOD! they almost killed your animal because so. did he give it a fecal exam? if not he shouldnt be treating anything! annual deworming also is not needed, but a fecal could be done annually but isnt typically needed. all he was doing was trying to fool you into more money for something that was more than likely not needed!

    another note some meds can and will kill the natural bacteria in the stomach which would also lead to the snake not wating to eat.

    ball pythons do not need trees! also wood is bad because you cannot disinfect it.

    my advice here is to find a real herp vet because this fool obviously slept through their 1 week class on reptiles.

    also you ball probally isnt eating because of that humidity. it should be around 60% tops

  9. #8
    BPnet Lifer Kaorte's Avatar
    Join Date
    09-24-2008
    Location
    Chicago
    Posts
    8,773
    Thanks
    2,211
    Thanked 2,580 Times in 1,923 Posts
    Images: 13

    Re: Anaphylactic Shock?

    For future reference, a full grown female BP will often go off feed in the winter months. It is very common. Get a scale and start monitoring your BP's weight. If she isn't loosing a considerable amount of weight, there is nothing to worry about.

    You really need to re-do your husbandry. Sounds like you have a lot of things that are off that can also cause a snake to go off feed.

    I would highly suggest moving her into a 41qt tub with paper towel substrate. I would get 1 identical plastic rock cave type hides. These should be very tight fitting and snug.

    Get a UTH that is controlled with a thermostat. 100* spikes can burn your snake! You should set the thermostat at 94*.

    You should be monitoring your temps digitally with probes. There is a great unit called the accurite weather station that will get the job done for you.
    http://www.weatherconnection.com/pro...9964&s=froogle
    Stick the probe on the inside of the enclosure right on top of the UTH, under the substrate. Then put the entire unit in the enclosure on the cool side.

    Your humidity should come WAY down. constant humidity that high can easily cause a respiratory infection.

    Also, get a new herp vet who is more qualified.
    ~Steffe

  10. #9
    Registered User Ed Chisholm's Avatar
    Join Date
    03-31-2009
    Location
    Fort Worth, Texas
    Posts
    60
    Thanks
    12
    Thanked 7 Times in 5 Posts
    Images: 3

    Re: Anaphylactic Shock?

    Thanks for your help. I have read a bunch on the BP, but "talking" with people like you with experience is a lot better. I have had nothing but success for the first three years, that is why it was such a surprise when she stopped feeding. I do use a thermostat with a probe inside the unit. The temperature at 100 is under the substrate, the substrate top ranges around 85- 95, depending on if the heater is going off an on. I will mae sure the humidity goes down, I do not keep it that high consistently. When she goes in shed mode I raise it, otherwise I try to maintain it between 50 -70%. You have been very helpful, and I will find another vet is I have a need in the future.

  11. #10
    BPnet Veteran frankykeno's Avatar
    Join Date
    04-17-2005
    Location
    Toledo, Ohio
    Posts
    19,814
    Thanks
    92
    Thanked 871 Times in 478 Posts
    Images: 33

    Re: Anaphylactic Shock?

    Folks, this is obviously a pet snake that the owner prefers to offer a more visibly appealing home to. While that can be more of a struggle to maintain it's not at all inappropriate in this situation - at least in my opinion.

    Ed, I'm no vet but I do think it's odd for any vet to automatically deworm any animal when there's no fecal done first to determine what, if any, worms are present and there's no indication that the animal is anything other than healthy (which by your post the vet himself/herself determined was the case). I would hesitate to take that snake back to that vet again.

    If possible could you post pics of this enclosure so we might help you tweak it a bit. It's a bit off on a couple of numbers but again, that's all fixable. As far as wood in there, I'd be careful just due to the tendency to build up bacteria on natural products in the warm, high humidity environment of a typical BP enclosure.

    I would also suggest a decent digital scale. I use the DX-7001 but really any good digital scale either meant for the kitchen or a postal type scale is good as long as it weighs in grams and goes high enough to hold the weight of a mature female BP. You can find them online or at most bigger department stores or office supply stores for around $30 or so.

    A lot of sexually mature snakes go off feed in the cooler months. In the wild she would be mating, building her eggs, laying them and then staying coiled on them until they hatched. Even though she's captive, those same urges still exist. As long as she's not losing any big amount of weight and she's obviously healthy just continue to offer her prey on a weekly or bi-weekly basis and when she's ready - she'll eat.
    ~~Joanna~~

  12. The Following 4 Users Say Thank You to frankykeno For This Useful Post:

    asplundii (04-01-2009),Freakie_frog (03-31-2009),Melicious (04-01-2009),missi182 (04-01-2009)

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1