» Site Navigation
2 members and 1,886 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,111
Threads: 249,262
Posts: 2,573,018
Top Poster: JLC (31,651)
|
-
Registered User
Calling All Mojave Breeders
So I was just curious for all of you breeders experienced with mojaves, have you ever produced any blue eyed lucys? How hard is it and what is the statistical occurrence in a clutch? Thanks
1.1 normals
1.0 pastel
1.0 het albino
1.1 BCIs
1.0 black lab
1.0 cockatiel
-
-
BPnet Veteran
Re: Calling All Mojave Breeders
I am not an experienced breeder...but my understanding is ....
MojavexMojave.....25% BEL
LesserxLesser....25% BEL
BEL is a recessive trait or superform with a 1/4 shot when both animals are a recessive carrier.
I have also learned that certain combos or matchups will give you a more pure white BEL then others...MojavexMojave being less brilliant then lets say a lesser xlesser clutch with a BEL.....
Again, I am still learning all this but I am pretty sure you got a 25% chance for the BEL
-
-
Re: Calling All Mojave Breeders
Any pairing with mojave,lesser, or butter will give you a BEL. It is not a recessive trait however, the BEL is the super form of the co-dominant trait. The pairings result in 25% Super (Homozygous), 50% Heterozygous, and 25% normal offspring.
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
BPnet Veteran
Re: Calling All Mojave Breeders
Sweeet! I was half right lol. Ty for the correction....it is a super form but not recessive...that helps me as well....ty "prays high school genetics teacher is not a member of bp.net!"
-
-
Registered User
Re: Calling All Mojave Breeders
Oh ok thanks guys I know there's several morphs these days that go into making them, just wondering how many generations it takes to produce solid whites like the NERD ones. Those are spectacular
1.1 normals
1.0 pastel
1.0 het albino
1.1 BCIs
1.0 black lab
1.0 cockatiel
-
-
Re: Calling All Mojave Breeders
Well if you have a 1.1 then in theory you could get a white snake in a single breeding. Unless the odds gods hate you.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|