» Site Navigation
0 members and 657 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
|
-
Registered User
Re: Has anyone crossed these yet?
if you use the properties link and open it as a webpage you can view the pic.
thats a crazy looking snake. I wonder if the albino comes from both the BP and the burm, or just one of them. I'd like to know more about this but the site looks to be in spanish.. I'm not much past cerveza in espanol lol.
-
-
Re: Has anyone crossed these yet?
you would have to breed the albino burmXalbino ball and breed the hets together.
-
-
Re: Has anyone crossed these yet?
BTW not too many people on here agree with hybrid breedings (i love them). I would suggest you join hybridhaven.net to talk about hybrids.
everyone has their opinions and we should respect that!!
-
-
Registered User
Re: Has anyone crossed these yet?
i dont know about a ball crossed with a burm but they have produced a wall ball python which is a woma python crossed with a ball. it has the woma's pattern but the balls size and shape. someone should try a a burm with a ball. be cool LOL
-
-
BPnet Veteran
Re: Has anyone crossed these yet?
 Originally Posted by bailey23
i dont know about a ball crossed with a burm but they have produced a wall ball python which is a woma python crossed with a ball. it has the woma's pattern but the balls size and shape. someone should try a a burm with a ball. be cool LOL 
burmball
-
-
Re: Has anyone crossed these yet?
 Originally Posted by Watever
The genome of both species are different. Well, enough for them to cross but still different.
Not because both albino gene are recessive that they result on the same allele on each specimen.
If they do, it would be a lot of "chance".
A lot of ghost and axanthic line, look the same but they are not compatible, that's because they are not on the same allele.
Actually the albino gene in both burm and balls could very well be the same gene depending on which type of albinism we are talking about.
A T- albino is a T- albino regardless of what species it is in.
So a T- burm x T- ball would give rise to T- burmballs.
It is rather simple. A T- animal has a complete lack of the tyrosinase enzyme. So if both parents lack the tyrosinase then neither can pass on a functional copy so all the offspring will lack tyrosinase and, therfore, be T-.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Has anyone crossed these yet?
Excellent explanation; thank you!
-
-
BPnet Veteran
Re: Has anyone crossed these yet?
 Originally Posted by asplundii
Actually the albino gene in both burm and balls could very well be the same gene depending on which type of albinism we are talking about.
A T- albino is a T- albino regardless of what species it is in.
So a T- burm x T- ball would give rise to T- burmballs.
It is rather simple. A T- animal has a complete lack of the tyrosinase enzyme. So if both parents lack the tyrosinase then neither can pass on a functional copy so all the offspring will lack tyrosinase and, therfore, be T-.
You are right, it could be it, but it could also not be.
When I said "lot of chance", I was exaggerating.
But what I was trying to say, not because the effect on the color of a gene is the same as another gene, that they are the same gene. Different gene can have the same effect without being the same. And getting them both together, doesn't mean they gonna have the effect too. But since both species are close enough in the genome and pythons haven't evolved much (compare to other species), they could be the same.
But I am just speculating here, since I have no studies, no knowledge (other than reading some biology books and website) on biology and genome.
Actually, I am not sure I want anyone to try. I don't really have problems with the hybrids but more with the people doing it. We can have the best intentions in the world, we never know when some idiots gonna sell or give them to others without letting them know they are hybrids, what ever the % left they could have. And what happen if a sickness is passed from one species to the other ? How are we gonna stop it from spreading in collection and may be in the wild ?
So I hope we never get there.
-
-
Re: Has anyone crossed these yet?
 Originally Posted by Watever
But what I was trying to say, not because the effect on the color of a gene is the same as another gene, that they are the same gene. Different gene can have the same effect without being the same. And getting them both together, doesn't mean they gonna have the effect too. But since both species are close enough in the genome and pythons haven't evolved much (compare to other species), they could be the same.
I am sorry, I am really trying to get what you are saying here but it must just be way to early for my brain cause I am not understanding...
Are you saying that just because we say albino does not mean we are talking about the same type of albino in both animals?? If that is what you are saying then yes, I agree. That was why I clarified that if it is, genetically, the same type of albinism (i.e. T-) between both parents then the offspring will also be albino. If the type of albinism is different then obviously there will be a non compatibility and the offspring would effectively be double het. But that same principle applies to within species as well. Like if you breed an T- ball to a LA ball you get double hets that are phenotypically normal.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Has anyone crossed these yet?
 Originally Posted by asplundii
I am sorry, I am really trying to get what you are saying here but it must just be way to early for my brain cause I am not understanding...
Are you saying that just because we say albino does not mean we are talking about the same type of albino in both animals?? If that is what you are saying then yes, I agree. That was why I clarified that if it is, genetically, the same type of albinism (i.e. T-) between both parents then the offspring will also be albino. If the type of albinism is different then obviously there will be a non compatibility and the offspring would effectively be double het. But that same principle applies to within species as well. Like if you breed an T- ball to a LA ball you get double hets that are phenotypically normal.
Well, first, I am sorry if you don't understand. My first language is french and not english, when I typed it yesterday it was late and it was just after a long day at work and university and watching a hockey game (with some beers).
You are right on what you are saying but that's not what I was trying to say.
I was trying to say that a albinism gene (T-) can differ from one species to another.
That geneticly they doesn't look the same (chromosome) but their effect are the same on the animal (not produce melamine).
A bit like the Cold virus (I know it's not a gene but it can help you understand what I am trying to say). There is a lot of variation of it, but the effect of it is the same.
The T- in the tiger/alligator/ball/burmese all have the same effect, keep the skin from producing melamine, but I am pretty sure if we were able to look at them under a microscopre, they wouldn't look the same and probably wouldn't been on the same loci.
Making the cross between both species (both showing albinism) not being albinos but het or double het.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|