» Site Navigation
1 members and 631 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,191
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
Re: Making the cleanest BEL
I think he was refering to Ralph's original Platinum Daddy's paintjob has yet been reproduced. They say it's possible that there's a hidden gene.
Although, I'm skeptical about the claim/myth
-
-
BPnet Veteran
Re: Making the cleanest BEL
I would guess that the info about not being able to produce lessers was a misinterpreted response to one of those "how do I make my own, I don't want to spend the money to buy one?" type questions.
For me I thought of it more as a trait that wasn't figured out yet or maybe even a polygenic trait. But that didn't sound right considering their availability, low prices, and the lack of all polygenic BP traits (to the best of my limited knowledge).
Thanks for the info about piedsXlessers hetfor pied. There are way too many morphs to keep straight when you're fairly knew to the hobby.
-
-
Re: Making the cleanest BEL
I'm not very sure about this, but I thought Ralph Davis did eventually produce more like the platty daddy? Isn't it lesser + hidden gene on the same locus?
As far as polygenic traits... well, first of all, as I understand that term, I've always thought it was a misnomer. Doesn't polyloci traits make more sense?
Anyway, I think there are lots of things with BPs that are probably polygenic traits. The coloring & patterning of normals are 2 likely examples. It is just a field that has not been researched much so far.
-
-
Re: Making the cleanest BEL
 Originally Posted by kc261
I'm not very sure about this, but I thought Ralph Davis did eventually produce more like the platty daddy? Isn't it lesser + hidden gene on the same locus?
Yes he did. There is one in the 07 breeding records. And he has a ButterDaddy in the 08 records
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Making the cleanest BEL
 Originally Posted by DutchHerp
Lesser platinums came from Ralph's original Platinum. All lesser platinums in captivity today came from Ralph's animal, but they are definitely being produced.
Lesser x normal = 50% lesser, 50% normal.
Actually that isn't true. You'll hear about "Wild type" Lessers from time to time that were imported that are Lesser Platinums. Word on the street is that Ralph got screwed over...
-
-
Re: Making the cleanest BEL
i thought the lesser X mojave was the cleanest???
-
-
Re: Making the cleanest BEL
 Originally Posted by BT41042
Ralph says the cleanest and whitest BEL is from a Pied bred to a Lesser Het Pied... 
He does say that, and he showed one in one of his videos, it's ridiculous.
-
-
Re: Making the cleanest BEL
 Originally Posted by Lucas339
i thought the lesser X mojave was the cleanest???
It is way cleaner than mojave X mojave, but I believe lesser x lesser is cleaner, at least on average. Individuals will always vary.
Lesser x mojave BEL is a cool thing in terms of breeding potential, though, since you will get both lessers and mojaves. Depending on what results you are trying to get though, that could be annoying, if for example you'd like to produce lesser pastels, but aren't as fond of the pastave.
-
-
Re: Making the cleanest BEL
 Originally Posted by AaronP
Actually that isn't true. You'll hear about "Wild type" Lessers from time to time that were imported that are Lesser Platinums. Word on the street is that Ralph got screwed over...
Actually, I'd say it is close to a miracle that the hidden gene ever paired up with lesser in the wild to produce the Platty Daddy. Big breeders have spent lots of money on animals that never proved to be genetic. The Platty Daddy did prove to be genetic, even if not in the way it was originally expected/hoped.
The only way I would call it "screwed" is if the person that sold it to Ralph knew that there were other lessers in the wild, that it was the same gene the Platty Daddy carried, and also had other animals known to carry the hidden gene.
-
-
Re: Making the cleanest BEL
 Originally Posted by kc261
The only way I would call it "screwed" is if the person that sold it to Ralph knew that there were other lessers in the wild, that it was the same gene the Platty Daddy carried, and also had other animals known to carry the hidden gene.
When I say screwed I'm saying that the person in Africa not only knew of it but was actually breeding it themselves. They're not idiots, they know what they have.
I also believe that we would have discovered the hidden gene eventually. Last year someone hatched out Plattys in a "Normal" to Lesser breeding. So I believe it was inevitable.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|