Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 745

0 members and 745 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,120
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 24

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: My chondro suddenly refused f/t mouse

    Quote Originally Posted by DavidG View Post
    as you can see, asp and myself have different methods. I wouldn't say either one is wrong, so many people do it so many different ways and a lot of them seem to work out fine.
    Yes indeed and I was not trying to say you were wrong My concern was more that, as an unsexed, it was a youngin and 2 weeks without for a youngin might cause problems...

    Cheapest light you can get that he can not see (debatable) is a standard red light for heating.
    You can get CF black lights for pretty cheap. And I was not shooting so much for not see as not disturb much. Black lights throw a softer glow (that some will argue is akin to moonlight, not sure I buy that but...) than a flashlight. That softer glow would allow him to see the snake and such without the harder glaring light of a flash light
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    DSGB (03-25-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1