Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 662

0 members and 662 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,114
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 24

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: My chondro suddenly refused f/t mouse

    DSGB,

    Okay, I can understand not wanting to learn sexing on a chondro. About how much does your animal weigh? I just want to get a feel if we are dealing with an animal that is a couple years old or something bit older.

    Also, forgot to ask, do you know locality?

    It seems unlikely but the flashlight might irk the animal enough to keep it from feeding. Might be worth looking into... If you can get a hold of one consider using a CF blacklight in a lamp in the same room. Should give you just enough light to see by and not disturb the snake too much. If you can not find a CF black light I might be able to hook you up with one if you can swing by Tech...

    Maybe I missed it but did you say if you heat the F/T once it was thawed? These guys will really key in on heat (note, do not try feeding after taking a hot shower, that is asking for trouble.)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    DSGB (03-25-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1