» Site Navigation
1 members and 1,867 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,073
Threads: 249,220
Posts: 2,572,813
Top Poster: JLC (31,651)
|
-
Re: Another Quick Question!!
 Originally Posted by anatess
You really meant to say EACH EGG has a 50% chance of becoming a pastel? So, if you are completely an unlucky sort of chap, you could POSSIBLY get an entire clutch of ALL normals. Right??? Or, on the flip-side, if you are the luckiest guy in the world you can have an ENTIRE clutch of super-pastels???
If that's the case, then it really is not a good thing to say 25% WILL BE normal because it is misleading, but more like each egg has a 25% CHANCE of being normal, right?
Or am I really completely wrong on this matter?   
You are not completely wrong. The percentages are nothing more than odds for each given egg. Nothing is absolute. So yeah, you could be really ungodly unlucky and get all normals or really ungodly lucky and get all super pastels (assuming you are breeding a pastel to a pastel.)
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Another Quick Question!!
I want to add that when pairing a homozygous snake to a heterozygous snake, you will ALWAYS get 50/50 odds on the outcome. It doesn't matter if the genes are dom/co-dom/recessive. It doesn't matter if they are on the same locus or not. Nothing. It will always be 50/50 odds. You just have to look at the specific genes to know 50% of what, and 50% of what other thing.
This is because of what BlueBead said: "Any Homozygenous animal will pass one gene to every offspring while a heterogenous animal will pass the gene to half of the offspring."
This is why you should learn punnett squares first, then worry about the details of each individual morph and whether it is dom, co-dom, or recessive, and what the super form looks like, etc. A lot of people think that visual albino x het albino and normal x spider and super pastel x cinnamon are different problems and try to work out (or just memorize) the answers individually. But they are the same problem with the same possible outcomes.
Visual albino x het albino = 50% visual albinos and 50% het albinos (100% hets, not phets)
normal x spider (I am assuming het spider, since the existence of a homo spider is debatable) = 50% normals and 50% spiders
super pastel x cinnamon = 50% pewters and 50% pastels
-
-
Registered User
Re: Another Quick Question!!
Ok I think I got the co-doms down. Last night I was making little charts for myself, and paring random co-dom morph's and figuring out what the outcome will be. Also I just kept reading through all the helpful responses on here, which cleared ALOT up! Now I want to move on with the recessives. I tried looking at the one genetics page that is really popular on here, but its still unclear to me how they work.
Now I know when two recessives of the same gene (piedXpied), means all pieds. But what happens when you take two different recessives like a pied and an albino or something? What happens when you take a recessive to a codom in both het and homo forms? We'll use a ClownXEnchi, and ClownXSuper-Enchi for an example.
PS There are no homozygous form of recessives and dominant traits right?
-
-
Re: Another Quick Question!!
It sounds like you are still not understanding some of the very basic stuff, and just like building a building, if you are trying to build knowledge on a base that is not solid, you'll end up with problems. I'll go over it quickly, which is not expected to teach you everything, but it should help you figure out where the holes in your knowledge are.
Genes come in pairs. Animals inherit those genes from their parents, one from each pair comes from the mother, and one from the father. Since the mother and father both had pairs, it is random which one of the 2 genes is passed on, so the offspring has a 50/50 chance at each one.
When an animal has a matched pair of genes, this is called homozygous. A homozygous parent will always pass the same thing on to their offspring, because no matter which gene is randomly selected, it is the same. There is still a 50/50 chance, but it is like flipping a penny and asking whether or not a copper colored side is up. It will always be copper.
When an animal has an unmatched pair of genes, this is called heterozygous. Again it is random which is passed on, but since they are different, there is a 50/50 chance which one will be inherited.
Remember that animals have THOUSANDS of different gene pairs. Each pair is called a locus. Some people find it easy to picture this like 2 rows of houses facing each other on a street. That is why we can have combo morphs. A pewter is a cinnamon pastel. A bumblebee is a spider pastel. That means at one locus (or the first pair of houses on the street), the pewter snake has one normal and one cinnamon, while the bee has 2 normals. At another locus (the next pair of houses on the street), the pewter has 2 normals and the bee has 1 normal and one spider. At a third locus, both of these snakes have one pastel and one normal. However, it is possible one has the pastel on the right side of the street, while the other has it on the left. That part doesn't matter. This is why when you do Punnett squares, it doesn't matter if you write aA or Aa, both will display the same trait or lack thereof. This is also why in any pairing, it does not matter which is the female and which is the male, as far as what offspring you'll get in that clutch. (Sometimes it will matter for making future pairings work out right).
Another thing you need to understand is that there isn't 1 normal gene. For every locus, there is a normal gene, and they are all different from each other. Again, this is why we can have combo morphs. Otherwise, a snake would either be normal or it wouldn't. But it can be normal at one locus, but a morph at a different locus.
Now, as far as dominant, co-dom, and recessive. First of all, in this post I'm going to explain co-dom the way it is used in BPs, which is not exactly the same as biology textbooks. A dominant gene will be expressed whether the animal is het or homo for that gene, and it will be expressed in the same way so you can't tell the difference. A co-dom gene will be expressed whether the animal is het or homo for that gene, but it will be expressed differently, so you can visually see if the animal is het (for example pastel) or homo (for example super pastel). Recessive genes are only expressed if the animal is homo for that gene. An animal that is het for a recessive is not visually distinguishable from an animal that does not carry the recessive gene at all.
Please note that recessive and dominant are the opposite of each other. This is because genes are recessive, dominant, or even co-dominant only in respect to each other. It is possible to have a gene that is recessive to one gene, but dominant or co-dominant to a different one, all on the same locus. Let's use albino as an example. We call albino a recessive gene because it is recessive in respect to normal. It is just as accurate to say that normal is dominant to albino. On a different locus, pinstripe is dominant to normal, and normal is recessive to pinstripe. Again, note that the normal gene that is dominant to albino is a totally different gene than the normal gene that is recessive to pinstripe.
I hope that clears up some things for you.
To answer some of the specific questions you asked in your last post:
There are homozygous forms of every morph. The question is whether or not those forms are visually different than the het form. For recessive, it is different, because the homo form is the only visual form. For dominant, it is the same as the het form. It is even possible that the homozygous form of some morphs is lethal, and depending on how & why it is lethal, it could happen very early in development so we'd never see anything other than slug eggs, if that. But just because we never see it does not mean it does not exist.
When you breed 2 different recessives... assuming they are visual (homo), you get an animal that is het for both of those traits. You could breed them together and have a chance at a double morph, which in your example would be an albino pied. This is because the 2 different morphs are located at different loci (locuses?). If the 2 different morphs did happen to be on the same locus, then you have to find out which of those 2 genes is dominant to the other one, or perhaps they'd be co-dominant to each other.
Recessive (visual or homo) to a het co-dom is exactly the same question you started this thread with. It is a homo to a het. 50/50 chance. The only question is 50/50 of what & what? You should be able to work this out easily by now. The visual recessive parent gives 1 gene to every offspring, so every offspring will be het for that recessive trait. The co-dom gives a normal to half the offspring, and a morph gene to half the offspring. So in your example, the offspring have a 50% chance of being enchi het for clown, and a 50% chance of being normal het for clown.
Recessive (visual or homo) to a homo (super) co-dom should also be easy to figure out once you've done the above step. In fact, it is even easier. Both parents give 1 gene to every offspring. There are no hets involved, so there are no 50/50 chances. Every offspring will be enchi het for clown.
-
The Following User Says Thank You to kc261 For This Useful Post:
-
BPnet Veteran
Re: Another Quick Question!!
 Originally Posted by kc261
Anatess, you are completely right. When talking about odds or percentages in the outcomes of genetic problems, it is always the chance that each egg has of carrying those genes. So in the example you quoted, it would be much more accurate to say "expect that about 25% will be normals" rather than declaring "25% will be normals".
However, since most people are lazy, it often gets abbreviated to something like "25% normals". Also, I think people assume that everyone understands that we are only talking about the odds, not guaranteed outcomes, but it is an issue that confuses a lot of people.
I would like to point out that both people are right. You can say "each egg has a 25% chance of being normal" and you can say "25% of the babies in the clutch should be normal".
This is due to "linearity of the expectation function". That when you SUM over all eggs, you can pull the probability out front.
expected normals = 25%*size of clutch = SUM{over all eggs} (25% chance for each egg).
It is perfectly correct to talk about this in either way. Per egg OR per clutch.
JonV
-
-
Re: Another Quick Question!!
 Originally Posted by kc261
When you breed 2 different recessives... assuming they are visual (homo), you get an animal that is het for both of those traits. You could breed them together and have a chance at a double morph, which in your example would be an albino pied. This is because the 2 different morphs are located at different loci (locuses?). If the 2 different morphs did happen to be on the same locus, then you have to find out which of those 2 genes is dominant to the other one, or perhaps they'd be co-dominant to each other.
Do you think this could be what is going on with the three color phases of albino retics? I've not followed them closely and it could well be caused by interaction with a completely separate gene but if there where two different albino mutant alleles of the same locus both recessive to normal but co-dominant to each other it could also explain the three phases.
-
-
Re: Another Quick Question!!
 Originally Posted by RandyRemington
Do you think this could be what is going on with the three color phases of albino retics? I've not followed them closely and it could well be caused by interaction with a completely separate gene but if there where two different albino mutant alleles of the same locus both recessive to normal but co-dominant to each other it could also explain the three phases.
I have absolutely NO idea about retic morphs.
I do know that there are a few corn snake morphs that are like this. One example is amel and ultra. They share the same locus. Both are recessive to normal, but they are co-dom to each other. So you can have amel (which is homo to be visual), ultra (which is homo to be visual), a non-visual het of either one, a normal which carries neither gene, or an ultramel. It is pretty interesting.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|