» Site Navigation
0 members and 763 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,066
Threads: 249,217
Posts: 2,572,779
Top Poster: JLC (31,651)
|
-
Registered User
Re: What's the Name of your BP
i dont have my bps yet but i have names! for the male it will be beezlebub and the female will be desdemona! i cant wait lol i hope they dont live up to the names!
1.0 BCI <Emery>
0.1 Hypo Het Moonglow BCI <Willow>
0.1 Ball Python <Shroomy>

-
-
Re: What's the Name of your BP
Dr. Teeth

Col. Mustard

Lamp
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: What's the Name of your BP
Col mustard looks angry
-
-
Re: What's the Name of your BP
Here's a few of the names without pics...
Steve Buscemi, Winona Rider, Lee Majors, John Cusack, Zu Zu Petals, Bosley, Darla, Willow, Giles, Gideon, Hendrix, Connor, Viola, Penelope, J.J.,
-
-
Registered User
Re: What's the Name of your BP
This is Hubert... formerly known as Zeke.

And my little female doesnt have a name yet.
Tina
0.1.1 Normal Ball Pythons- Hubert and Cefira
2.1 Pitbulls- Roscoe. Jake. Ellie
1.0 Great Pyrenees- Kodiak
0.0.1 Yellow Spotted Salamander- Salamander
0.1 Marbled Salamander- Mandie
-
-
Registered User
Re: What's the Name of your BP
Normal - Ophion (O fee on)
Normal - Eurynome (yur uh nome)
Pastel - Bob (the 3 year old named this one)
Albino King - Aria (Are E Uh)
2.0 Normal BP
0.1 Pastel
0.1 Albino Cal King
1.1 Albino ASF
0.0.3 YellowBelly Sliders
1.1 Orange Cats
0.0.2 Goldfish
-
-
Re: What's the Name of your BP
 Originally Posted by LadyOhh
Unagi, Lafawnduh, Kip, POG, Gee, Spotty McGillicutty, Chipo, Bayo, Ayo, Dayo, Wamuiru, Panya, Gerda, Zuri, Daliah......
Those are the ones I can remember off the top of my head. Most of them are just called (Insert Morph) and (#X)...
Sauda, Kamili, Chin, Ifama, Nayah, Soshie, TV, Nadra, Ijaba, Najah, Cable.....
-
-
BPnet Veteran
-
-
BPnet Veteran
Re: What's the Name of your BP
my girls name is 'bally'...original i know
-
-
BPnet Veteran
Re: What's the Name of your BP
 Originally Posted by Rejekt
i dont have my bps yet but i have names! for the male it will be beezlebub and the female will be desdemona! i cant wait lol i hope they dont live up to the names!
Desdemona eh, first thing that comes to mind is Othello
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|