» Site Navigation
0 members and 1,089 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,142
Posts: 2,572,364
Top Poster: JLC (31,651)
|
-
Re: everybody better wake up & know about the ban!!
The easiest way to die a quiet death is to sit by and do nothing:
When they came for the communists,
I remained silent;
I was not a communist.
When they locked up the social democrats,
I remained silent;
I was not a social democrat.
When they came for the trade unionists,
I did not speak out;
I was not a trade unionist.
When they came for the Jews,
I remained silent;
I was not a Jew.
When they came for me,
there was no one left to speak out.
Some of these ban bills do not just call for stopping importing and trade across state lines. Some call for a ban on all breeding. How are you going to get new snakes then, even in your state? Some call for a ban on keeping your snakes. What are you going to do with the snakes you have? Are you going to volunteer them up for euthanasia? Or just kill them yourself?
If you want to pretend that it will not affect you that is your choice but kindly do not criticize those of us that take it a bit more seriously.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: everybody better wake up & know about the ban!!
 Originally Posted by azpythons
Shoot america aint all its cracked up to be..land of the free my anus.
We have this joke in the Philippines... it goes in-between the Philippines versus America contests, kinda like the Yo Momma jokes. American says, America is the Land of the Free. Filipino says, but you are not free to pee on the wall! It's supposed to be hilarious but sometimes it makes me stop to think. Yeah, banning wall-peeing is cool for the good of the community. But, it shows that the public cannot be trusted to care enough about the community to not pee on the wall. Whereas, educating the people about the perils of wall-peeing (improper hygiene causing spread of disease and what-have-you plus suffering the odor everytime you walk by) and changing the culture so that people show pride for their community, might achieve the same effect. But hey, I do understand that in a perfect world education would be enough. In reality, there is always that one doofus who ruins it for everybody!
----------------------------------
BP owner since Oct 2008, so yeah, I'm no expert.
0.1.0 pastel bp
1.0.0 spider bp
0.1.0 albino bp
1.0.0 bumblebee bp
1.0.0 yellowbelly bp
0.0.1 normal bp
1.0.0 normal western hognose
Life should NOT be a journey to the grave with the intention of arriving safely in an attractive and well preserved body, but rather to skid in sideways, chocolate in one hand, body thoroughly used up, totally worn out and screaming "WOO HOO what a ride!"
-
-
BPnet Veteran
Re: everybody better wake up & know about the ban!!
 Originally Posted by mricyfire
it seems like it will affect the breeders not so much the consumers, depending on your state of course. Every type of snake i could afford anything under $3000 can be found in florida for the most part, but lets say you are in tenn. And the snake you want is in florida, if you want it bad enough i am pretty sure you will make the trip, i know peeps that do it for guns and cars, so why not snakes esp. The price some of them are.
Don't get me wrong i love bhb and 8ball they are 2 of my top 5 breeders, but as the little guy consumer with 2 snakes total and maybe a max of 4 down the road, this will have little affect to me and many other small time snake owners.
See what i mean?
no more pythons period!!!!! Wake up people they are trying to ban them outright don't be stupid join the fight for our rights,listen to reptileradio.com its comming if you sit back in this aminstration your rights to own reptiles is gone!!!!!
-
-
BPnet Veteran
Re: everybody better wake up & know about the ban!!
If they pass this kiss all the web sites goodby!!!! All the breeders goodby all of your pythons turned in & killed!!!! Thats whats going to happen if you sit back & be passive go to the links i provided & read about it you will be ammazed at what they are doing & the python owner with 1 or 2 snakes will be lawbreakers too!!!!!! People wake up join usark or call write email your state senators!!! Be polite & smart .
-
-
Registered User
Re: everybody better wake up & know about the ban!!
 Originally Posted by rabernet
And we don't endorse illegal activity here at BP.net - so you could only buy ball pythons from breeders in your state - if they stay in business. Nor do we allow members to advocate illegal activity. Please be mindful of our TOS.
What will happen when everything is illegal?
Back in 2004 there was the so called "steriod ban" and it didn't target steriods at all, it went after prohormones that had been legal for years and were proven to cause no harm. Now the legal prohormones that it left legal are VERY hard on your liver and cause cancer! A few friends of mine that were taking those with me made the jump to steriods just because if they were ever caught with either it was the same jail time! It was total bs, all they ever do is create a black market and that is what the current administration is going to be good at.
-
-
BPnet Veteran
Re: everybody better wake up & know about the ban!!
 Originally Posted by mricyfire
Explain the ban...and is it really that big of a deal?
Drugs are illegal and sure are the easiest things to get, dont see much difference here.
And if i remember correctly it will just ban interstate trade or something like that?...but it is one of those things that is going to be impossible to regulate, you can easily put a ball python in cargo shorts pocket drive to whereever and continue your transaction
"where there is a will, there is a way"
Wow what a great attitude, your a credit to your hobby.
"If I were stranded on a desert island and could only have one book, record and person...I'd probably die of exposure."
czphotography
-
-
BPnet Veteran
Re: everybody better wake up & know about the ban!!
oh but wait when i posted this months ago no one even said anything. way to stand up! or the lets go sign some stupid petition. the point is that if your not flooding congress with letters then you are part of the problem
-
-
Re: everybody better wake up & know about the ban!!
 Originally Posted by nixer
oh but wait when i posted this months ago no one even said anything. way to stand up! or the lets go sign some stupid petition. the point is that if your not flooding congress with letters then you are part of the problem
Nixer, after your first post i contacted bill nelson via email that day and again today.
Nixer is right!! send emails!! I have sent mulitple to nelson and those that are in favor of HR669. When sending emails to those for HR669, you have to make sure you put in that you live in their state. the system will reject emails if they are not in the district using a zip code search. I use the zip code listed for that person's office.
THIS WILL END OUR HOBBY!!!
-
-
BPnet Veteran
Re: everybody better wake up & know about the ban!!
 Originally Posted by Lucas339
Nixer, after your first post i contacted bill nelson via email that day and again today.
Nixer is right!! send emails!! I have sent mulitple to nelson and those that are in favor of HR669. When sending emails to those for HR669, you have to make sure you put in that you live in their state. the system will reject emails if they are not in the district using a zip code search. I use the zip code listed for that person's office.
THIS WILL END OUR HOBBY!!!
here is how:
house of rep.
https://writerep.house.gov/writerep/welcome.shtml
congress
http://www.senate.gov/general/contac...nators_cfm.cfm
heres the committees
http://www.senate.gov/pagelayout/com...ttees_home.htm
list of bills
http://www.congress.org/congressorg/issuesaction/bill/
also note that you dont have to be 18 to contact congress or the house. so even you younger folks can do so just keep it well spoken and non attacking. also i would keep threats to a min.
-
-
Registered User
Re: everybody better wake up & know about the ban!!
well im canadian nothing i can do for you guys except suggest you try and do something about it or move here lol
1.0 Ball Python: Monty
0.1 Red Tail boa: Dixie
0.1 Tree Boa: Carmen

-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|