» Site Navigation
0 members and 1,622 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,073
Threads: 249,220
Posts: 2,572,813
Top Poster: JLC (31,651)
|
-
Re: 2 hets do what?
 Originally Posted by asplundii
There is not such thing as a 100% probable  When probability hits 1 it is a certainty, all chance removed.
Good point. 100% are called "het for...", below that it's called "probable het for..." or "possible het for..."
-
-
BPnet Veteran
Re: 2 hets do what?
 Originally Posted by asplundii
There is not such thing as a 100% probable  When probability hits 1 it is a certainty, all chance removed.
However, you will see hets advertised as 100% het for ????. They've simply left out the word probable.
There IS a such thing as 100% probable. The probability of that animal being heterozygous for the trait is 100%. I don't like the terminology 100% het for ??? because if it is a het, it is 100%. A 50% probable het for ??? does not hold 50% of a gene for that trait, it has a 50% chance of having the gene. So, when percentages are used, the word probable should be used as well.
You are correct that when probability hits 1 it is a certainty and all chance is removed. There's not much chance of a negative outcome when the probability is 100%, is there?
Because it is SO common to see 100% used in advertising hets, it has to be considered, and needs to be clarified.
Steve
-
The Following User Says Thank You to hoo-t For This Useful Post:
ParmleyStyle (03-06-2009)
-
Re: 2 hets do what?
I guess we just define "probability" differently. My way of thinking of it is that probability is a measure of chance.
Think of it this way, a flipped coin in the air has a 50% probability (chance) of landing heads up. However, once it has landed all probability (chance) is removed; it either is heads up or it is not heads up.
So it is with hets. They either are or are not. I think people use the 100% to indicate it is indeed an actual het while the 50% and 66% ones are still "coins up in the air yet to land" as it were.
Because it is SO common to see 100% used in advertising hets, it has to be considered, and needs to be clarified
I agree it is good to clear things up
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: 2 hets do what?
And I would assume that a 66% poss het that gave birth to an albino baby can now be sold as het albino without further percent qualification.
I do see what you mean when you say, if you put 100% then it is proper to add poss. Otherwise, just drop 100% altogether... It's like saying, "Can you repeat it again for the second twice?"... Just being funny, guys...
----------------------------------
BP owner since Oct 2008, so yeah, I'm no expert.
0.1.0 pastel bp
1.0.0 spider bp
0.1.0 albino bp
1.0.0 bumblebee bp
1.0.0 yellowbelly bp
0.0.1 normal bp
1.0.0 normal western hognose
Life should NOT be a journey to the grave with the intention of arriving safely in an attractive and well preserved body, but rather to skid in sideways, chocolate in one hand, body thoroughly used up, totally worn out and screaming "WOO HOO what a ride!"
-
-
BPnet Veteran
Re: 2 hets do what?
 Originally Posted by asplundii
I guess we just define "probability" differently. My way of thinking of it is that probability is a measure of chance.
Think of it this way, a flipped coin in the air has a 50% probability (chance) of landing heads up. However, once it has landed all probability (chance) is removed; it either is heads up or it is not heads up.
So it is with hets. They either are or are not. I think people use the 100% to indicate it is indeed an actual het while the 50% and 66% ones are still "coins up in the air yet to land" as it were.
I agree it is good to clear things up 
You're absolutely right. Once the coin has landed "heads" it has no chance of being "tails" - 0% probability. But I see your point, and I agree. But, its a common practice in the ball python world to advertise hets as "100%". So whether we like it or not, we have to consider it. Its kinda like the whole co-dominance vs incomplete dominance thing. Co-dominance is most likely not an accurate description of what we consider to be co-dominant traits in ball pythons. But it is so widely used, that we really can't avoid it.
-
-
Re: 2 hets do what?
 Originally Posted by asplundii
So it is with hets. They either are or are not. I think people use the 100% to indicate it is indeed an actual het while the 50% and 66% ones are still "coins up in the air yet to land" as it were.
Good analogy, except depending on who reads it, it might give the wrong impression. I think a slightly more accurate way of saying it is that phets are like coins that have landed, but no one has looked to see which side is up. The snake either is het or it isn't (the coin has landed), the issue is just that we have no way of knowing until we breed it to prove it out (look at the coin).
-
The Following User Says Thank You to kc261 For This Useful Post:
ParmleyStyle (03-06-2009)
-
BPnet Veteran
Re: 2 hets do what?
 Originally Posted by anatess
And I would assume that a 66% poss het that gave birth to an albino baby can now be sold as het albino without further percent qualification.
I do see what you mean when you say, if you put 100% then it is proper to add poss. Otherwise, just drop 100% altogether... It's like saying, "Can you repeat it again for the second twice?"... Just being funny, guys...
Yup, once its proven, its no longer a 66% probable het, its...ummm... 100% (ducking now).
Another OT analogy I thought of is when someone asks you to enter your "pin number". If you expand the acronym, they're asking for your personal identification number number.
Steve
-
-
Re: 2 hets do what?
 Originally Posted by anatess
And I would assume that a 66% poss het that gave birth to an albino baby can now be sold as het albino without further percent qualification.
I think that is where the word "proven" usually comes in.
-
-
Re: 2 hets do what?
 Originally Posted by hoo-t
Yup, once its proven, its no longer a 66% probable het, its...ummm... 100% (ducking now).
Another OT analogy I thought of is when someone asks you to enter your "pin number". If you expand the acronym, they're asking for your personal identification number number.
Steve
Yes, and ATM machine. Apparently redundancy was popular around the time those things were invented!
Last edited by kc261; 03-06-2009 at 02:53 PM.
Reason: typo
Casey
-
-
BPnet Veteran
Re: 2 hets do what?
 Originally Posted by kc261
I think that is where the word "proven" usually comes in.
The word "proven" also comes in with the "100% hets" though. I know that there is no way I'd sell a het that I didn't produce as 100% unless I had proved it.
By the way, I love your coin analogy!
Steve
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|