» Site Navigation
2 members and 1,920 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,706
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
BPnet Veteran
Does it exsist?
Has any one created the all ORANGE BP Albino Cinny X Albino Cinny
-
-
BPnet Veteran
Re: Does it exsist?
super cinny albino has been done, saw an ad on KS a while back. that would be a great male to pair with your albinos.
JonV
-
-
BPnet Veteran
-
-
Re: Does it exsist?
The albino super cinny is all white, not all orange. For an all orange snake you would need something like RDR's or VPI's patternless (i.e. an albino all gold snake)
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Does it exsist?
And has a Piebald Super Cinny been created
-
-
BPnet Veteran
Re: Does it exsist?
I can't seem to find one...can anyone help us out? Or am I recalling incorrectly that it has been done at all?
JonV
-
-
BPnet Veteran
Re: Does it exsist?
 Originally Posted by B@LLZ4LIFE
And has a Piebald Super Cinny been created
actually its a pied super black pastel but yes it is called the panda pied.
http://ballroompythonssouth.com/cata...roducts_id=346
-
-
Re: Does it exsist?
Both have been done, and I was disappointed by both of them. I was hoping for a solid yellow or orange snake and a more zebra looking snake, I guess.
-
The Following User Says Thank You to PythonWallace For This Useful Post:
-
BPnet Veteran
Re: Does it exsist?
i dont know bout disappointed...but the super cinny albino was a waste of time imo cuz its common sense that it will be another all white snake. also i did want them to call the panda pie a cow pie! haha and i wanted it to have a lot more black. The panda pie ROCKS tho
you gotta get crazy creative to think up a snake that hasnt been done. pretty hot snakes tho huh. also i bet a GS albino would be close to all orange
pin albino bp in the making 
-
-
BPnet Veteran
Re: Does it exsist?
Im sure down the line some one will get a Panda Pied lookin like a zebra and the all Orange snake from breeding Albino Cinnys
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|