Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 622

1 members and 621 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,201
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 25

Thread: Warning: S373

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Warning: S373

    Quote Originally Posted by Melicious View Post
    Be Polite & Professional. If you can't do this don't bother because it will damage our efforts.


    Quote Originally Posted by anatess View Post
    My last paragraph says that S373 is an ignorant bill.
    Guys, remember to be courteous and polite with this. Calling the bill ignorant is, in effect, calling the people who penned it and the people who support it ignorant and that can be insulting and does not help the cause.

    These people are not ignorant they are just uninformed, misinformed or being intentionally fed disinformation by people who have an agenda and enough clout to get heard. We need to make it our job to provide them with the means to expand their knowledge on the subject. Provide them with the valid information they need to rethink the situation. Refer them to the Barker's articles that detail the flaws in the USGS report. Show them that we are responsible keepers who want what is best for everyone and all side by suggesting alternatives (i.e. permits for large constrictors, cage standards, etc...)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #12
    BPnet Senior Member anatess's Avatar
    Join Date
    11-13-2008
    Posts
    1,799
    Thanks
    133
    Thanked 502 Times in 311 Posts
    Images: 5

    Re: Warning: S373

    Quote Originally Posted by asplundii View Post
    Guys, remember to be courteous and polite with this. Calling the bill ignorant is, in effect, calling the people who penned it and the people who support it ignorant and that can be insulting and does not help the cause.

    These people are not ignorant they are just uninformed, misinformed or being intentionally fed disinformation by people who have an agenda and enough clout to get heard. We need to make it our job to provide them with the means to expand their knowledge on the subject. Provide them with the valid information they need to rethink the situation. Refer them to the Barker's articles that detail the flaws in the USGS report. Show them that we are responsible keepers who want what is best for everyone and all side by suggesting alternatives (i.e. permits for large constrictors, cage standards, etc...)
    I disagree. Calling a BILL ignorant is not the same as calling Senator Nelson ignorant. Give me some credit. English is my second language, therefore I had to study it for 12 years to garner a bachelor's degree. Even on professional forums unlike this one, I find that I have a better command of English than a lot of Americans who take the language for granted. But, of course, I can still mispell "hemiphene". In this case, though, I'm fairly sure "ignorant" is not insolence in that context.

    And it was the last paragraph of an email that provided all sorts of information on ball pythons as well as special mention of the permit process already in place in Florida. And, having worked for the Philippine Congress for a few years, I have learned that these politicos are very careful with their image. Anything that might have a negative impact on their image, they will pay closer attention to, therefore, a bit of mention on it, might get noticed among thousands of other emails both pro and con.
    Last edited by anatess; 03-05-2009 at 01:49 PM.
    ----------------------------------
    BP owner since Oct 2008, so yeah, I'm no expert.
    0.1.0 pastel bp
    1.0.0 spider bp
    0.1.0 albino bp
    1.0.0 bumblebee bp
    1.0.0 yellowbelly bp
    0.0.1 normal bp
    1.0.0 normal western hognose


    Life should NOT be a journey to the grave with the intention of arriving safely in an attractive and well preserved body, but rather to skid in sideways, chocolate in one hand, body thoroughly used up, totally worn out and screaming "WOO HOO what a ride!"

  3. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Warning: S373

    Quote Originally Posted by anatess View Post
    But, of course, I can still mispell "hemiphene".
    And misspell is seems (sorry, just playing there.)

    In this case, though, I'm fairly sure "ignorant" is not insolence in that context
    I see what you are getting at but I tend to take a stand that things written, especially on the net, have no other context and so potentially loaded words, like "ignorant", usually get the worst connotation attached to them. So while I am sure you did not mean or intend to call Sen. Nelson ignorant it is possible that just by using a "volatile" word the wrong context could transfer over. I have been guilty of this myself and I am sure I will be again.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #14
    BPnet Senior Member anatess's Avatar
    Join Date
    11-13-2008
    Posts
    1,799
    Thanks
    133
    Thanked 502 Times in 311 Posts
    Images: 5

    Re: Warning: S373

    Quote Originally Posted by asplundii View Post
    And misspell is seems (sorry, just playing there.)
    Yeah, the misspelling was on purpose. DutchHerp called me on "hemiphene" on some other thread. That guy at age 17 can write great English as well. I could be wrong but I think English is not his first language either.

    Quote Originally Posted by asplundii View Post
    I see what you are getting at but I tend to take a stand that things written, especially on the net, have no other context and so potentially loaded words, like "ignorant", usually get the worst connotation attached to them. So while I am sure you did not mean or intend to call Sen. Nelson ignorant it is possible that just by using a "volatile" word the wrong context could transfer over. I have been guilty of this myself and I am sure I will be again.
    But see, this letter was not on a forum, nor a public informal venue, nor a text message where you can say LOL. This was a formal letter written to a United States Senator, who couldn't have gotten to the senate seat without knowing the difference between insolence and criticism.

    But, that's beside the point. Discussing linguistics is veering us off the dire matter at hand.
    ----------------------------------
    BP owner since Oct 2008, so yeah, I'm no expert.
    0.1.0 pastel bp
    1.0.0 spider bp
    0.1.0 albino bp
    1.0.0 bumblebee bp
    1.0.0 yellowbelly bp
    0.0.1 normal bp
    1.0.0 normal western hognose


    Life should NOT be a journey to the grave with the intention of arriving safely in an attractive and well preserved body, but rather to skid in sideways, chocolate in one hand, body thoroughly used up, totally worn out and screaming "WOO HOO what a ride!"

  5. #15
    BPnet Veteran DutchHerp's Avatar
    Join Date
    05-10-2008
    Location
    Texas
    Posts
    2,315
    Thanks
    605
    Thanked 410 Times in 298 Posts
    Images: 6

    Re: Warning: S373

    Quote Originally Posted by anatess View Post
    Yeah, the misspelling was on purpose. DutchHerp called me on "hemiphene" on some other thread. That guy at age 17 can write great English as well. I could be wrong but I think English is not his first language either.
    If you're referring to me, I'm 14 and English is not my first language; I had to learn it from scratch 3.5 years ago.
    MH

    Who the hell is Pat?

    "Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes

  6. #16
    BPnet Veteran ScottyDsntKnow's Avatar
    Join Date
    08-29-2008
    Location
    Andalucia, Espana
    Posts
    377
    Thanks
    3
    Thanked 70 Times in 37 Posts

    Re: Warning: S373

    I actually have a pretty solid grounding in politics and here is what I've seen in this thread so far that could be improved...

    1- Do NOT call a bill ignorant, even suggest that someone is currently NOT respectable, or accuse a political party of using fear/panic tactics. It WILL be taken personally whether it is meant to or not.

    2- Nobody besides Herp enthusiasts or biology majors will understand what you are talking about when you say Boids or even what a Ball Python is. You often need to word these things like you are speaking to a 5 year old. I didn't say talking down to one, I said speaking to one.

    3- Use statistics and comparisons. Get current figures on the herp industry, the gross income it produces, how large it is compared to say the Dog or Cat industry, percentage of business it generates in the whole Pet industry etc... Using stats like "large" or "significant" won't do anything for you.

    4- Discretion is the better part of valor. These guys ARE the law and if you come off as even insulting or condescending at all it'll just give them more of a reason to go against what you want, if nothing else out of spite.

  7. The Following 4 Users Say Thank You to ScottyDsntKnow For This Useful Post:

    Caskin (03-05-2009),DutchHerp (03-05-2009),Muze (03-05-2009),Slim (03-05-2009)

  8. #17
    Registered User Caskin's Avatar
    Join Date
    10-21-2007
    Location
    Monte Vista, CO/Savannah, GA
    Posts
    85
    Thanks
    20
    Thanked 14 Times in 8 Posts

    Re: Warning: S373

    Quote Originally Posted by ScottyDsntKnow View Post
    3- Use statistics and comparisons. Get current figures on the herp industry, the gross income it produces, how large it is compared to say the Dog or Cat industry, percentage of business it generates in the whole Pet industry etc... Using stats like "large" or "significant" won't do anything for you.
    Those things would be amazingly helpful! I'd love to be able to use some actual facts to make my case instead of just making up random numbers as a closest guess. Is that huge list of statistics that kingsnake.com came up with for the NOI last year still around? That had lots of good info.

    If we can gather the info up and post it here, the easier for everyone else to find it.
    -Bethany Berg
    1.1 Ball Pythons
    1.2 Cornsnakes .. 1.0 Kenyan Sand Boa .. 1.0 Rosy Boa
    3.7 Leopard Geckos .. 1.0 Crested Gecko .. 1.0 Gargoyle Gecko

    Photography on Flickr

  9. #18
    BPnet Senior Member anatess's Avatar
    Join Date
    11-13-2008
    Posts
    1,799
    Thanks
    133
    Thanked 502 Times in 311 Posts
    Images: 5

    Re: Warning: S373

    Quote Originally Posted by ScottyDsntKnow View Post
    I actually have a pretty solid grounding in politics and here is what I've seen in this thread so far that could be improved...

    1- Do NOT call a bill ignorant, even suggest that someone is currently NOT respectable, or accuse a political party of using fear/panic tactics. It WILL be taken personally whether it is meant to or not.
    Okay, I'm sorry to veer a little bit off topic again, but this is a peeve of mine. I'm usually a very tolerant person, but, I feel that my use of the word "ignorant" was singled out as an example of a disrespectful, derogatory, even incendiary remark for which I am quite disappointed.

    A few years ago, this blue-eyed, blonde Harvard professor came on TV to say that the word Oriental is derogatory and politically incorrect. Excuse me. I am Filipino and I AM oriental and I use oriental among other things to describe people hailing from lands east of Rome. Just because somebody decided to black-list a word doesn't mean it is not a proper word to use in a sentence when applied in its proper context!

    For example, here are 2 sentences:
    1.) While he is an expert in ball pythons, he is ignorant of the effects of climate change on the survival of the species.
    2.) He is so ignorant, it amazes me how people still give him any credit.

    The 2nd sentence is obviously an insult. The 1st sentence is using the word ignorant to describe his level of knowledge and is not incendiary. It is okay to use it in a scientific document or a formal letter to a US Senator!

    In any case, if you feel so strongly that it will derail the petition against S373, then don't use it. As for me, I would like to give Senator Nelson the benefit of knowing the difference between the 1st sentence and the 2nd sentence above. I just wish people would stop using it as an example of a derogatory, "class"-less statement! Meh... pipe dreams.

    I'm off the podium now. Thanks.
    ----------------------------------
    BP owner since Oct 2008, so yeah, I'm no expert.
    0.1.0 pastel bp
    1.0.0 spider bp
    0.1.0 albino bp
    1.0.0 bumblebee bp
    1.0.0 yellowbelly bp
    0.0.1 normal bp
    1.0.0 normal western hognose


    Life should NOT be a journey to the grave with the intention of arriving safely in an attractive and well preserved body, but rather to skid in sideways, chocolate in one hand, body thoroughly used up, totally worn out and screaming "WOO HOO what a ride!"

  10. #19
    Broken down old dude dsirkle's Avatar
    Join Date
    09-15-2007
    Location
    Plymouth Twp Michigan
    Posts
    4,745
    Thanks
    481
    Thanked 988 Times in 649 Posts
    Images: 31

    Re: Warning: S373

    I sent an email opposing this bill.
    Do not resuscitate

  11. #20
    BPnet Veteran ScottyDsntKnow's Avatar
    Join Date
    08-29-2008
    Location
    Andalucia, Espana
    Posts
    377
    Thanks
    3
    Thanked 70 Times in 37 Posts

    Re: Warning: S373

    Quote Originally Posted by anatess View Post
    Okay, I'm sorry to veer a little bit off topic again, but this is a peeve of mine. I'm usually a very tolerant person, but, I feel that my use of the word "ignorant" was singled out as an example of a disrespectful, derogatory, even incendiary remark for which I am quite disappointed.

    A few years ago, this blue-eyed, blonde Harvard professor came on TV to say that the word Oriental is derogatory and politically incorrect. Excuse me. I am Filipino and I AM oriental and I use oriental among other things to describe people hailing from lands east of Rome. Just because somebody decided to black-list a word doesn't mean it is not a proper word to use in a sentence when applied in its proper context!

    For example, here are 2 sentences:
    1.) While he is an expert in ball pythons, he is ignorant of the effects of climate change on the survival of the species.
    2.) He is so ignorant, it amazes me how people still give him any credit.

    The 2nd sentence is obviously an insult. The 1st sentence is using the word ignorant to describe his level of knowledge and is not incendiary. It is okay to use it in a scientific document or a formal letter to a US Senator!

    In any case, if you feel so strongly that it will derail the petition against S373, then don't use it. As for me, I would like to give Senator Nelson the benefit of knowing the difference between the 1st sentence and the 2nd sentence above. I just wish people would stop using it as an example of a derogatory, "class"-less statement! Meh... pipe dreams.

    I'm off the podium now. Thanks.
    I feel the same way as you do personally. HOWEVER, this guy wrote the bill and you calling it ignorant is calling him ignorant by association. I know you didn't mean it that way but it WILL be taken that way. Even using the word uninformed would be iffy here. I know its ridiculous but that's just how it is. I personally would have used an example such as:

    Honorable Sir or Ma'am,

    I write to you to ask that you please consider voting NO to S373 which would impose a federal trading ban on all species of pythons and boa constrictors. While I understand your concern about the feral population of Burmese Pythons in the Everglades and possible propagation of a non-native species to other areas, this bill does not address this issue itself, nor does it provide a solution for removal of these animals.

    The Burmese Python issue is a South Florida issue not a national one. There is no credible evidence to show that these animals can exist north of Lake Okeechobee. Out of all the Pythons and Boas imported into the US over the last 50 years, only Burmese Pythons have ever established a breeding wild colony and only in South Florida. No evidence exists anywhere to suggest that banning all Pythons will have any positive impact on the effected area in the southern tip of Florida as it does nothing to address the issue that these animals are already living there. Banning the interstate trade of all pythons does nothing to solve this. To the contrary, it will destroy thousands of small businesses and further damage and already fragile economy.

    While some may not consider a snake a pet, the herpetological(sp?) industy is growing by leaps and bounds. According to the American Pet Products Manufacturers Assn. 2007-2008 pet owners’ survey, the total number of reptiles owned in the United States increased 22 percent since the survey was taken two years ago, from 11 million to 13.4 million. In response, pet manufacturing companies, supply companies and retailers everywhere are moving to meet the demand.

    “The reptile market is a growing one,” says Kevin Wai, managing director of AquaTerra International in Los Angeles. “As the aquarium industry is becoming saturated with products, manufacturers are now turning toward the reptile industry. They see the growth potential and the rising popularity of reptiles as pets and now they want to get involved.”

    The proposed trade ban of Pythons and Boa Constrictors will severely restrict or even halt the rapid growth of the industry as these two animals are some of the most popular reptile pets. Yes, it is true that larger constricting snakes such as the animals currently living in the Everglades can grow to up to 20 feet and are dangerous for inexperienced keepers. However, the most common constricting snakes kept as pets, Ball Pythons(python regius) top out at 6 feet with most specimens only ever reaching about 4 feet and the thickness of a 12 oz. aluminum beverage can. These animals are not dangerous. Even the larger Boa Constrictors are considered the most docile of all constricting snakes and great pets able to be handled by one person.

    Banning the interstate trade of these animals because one species is a problem in an isolated area is unfair. Would an interstate trade ban of dogs be fair to the canine community because one breed became a problem in one area of one state? I would understand requiring permits for larger constricting snakes as they can be dangerous and should only be owned by experienced, trained keepers but a straight up ban is unnecessary for a small animal such as a ball python.

    As mentioned previously, this ban will be financially devastating. It will destroy thousands of hardworking American families and small businesses. Not just the breeders and dealers who make most of their sales worldwide, but hobbyists, dry goods, equipment manufacturers, food providers, shippers, trade shows, hotels and restaurants. In an already precarious economy do we really want to create even more economic hardship?

    In closing, as a herpetology enthusiast and hopeful future breeder I again implore you to vote NO to this proposed bill. I know that a snake is not the ideal perfect pet for everyone but not everyone is a dog or cat person either. There are millions of us who love these reptiles and want to continue to enjoy them and all they have to offer.

    Very Respectfully,
    NAME

    IMO that is how you communicate with these people. No I don't have very many statistics in there but I do have a reliable source and a quote. Rationalizing also plays a good part. I did say unfair, but that is much different than using the word ignorant. I'm not trying to pick on anyone in particular, I just saw that word in a post and yes it does stick out. Hopefully what I wrote can be expanded on and improved. I know I'm not the greatest writer in the world and what I wrote up there needs a bunch of editing and probably some more good information but its a start.
    Last edited by ScottyDsntKnow; 03-06-2009 at 12:24 AM.

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1