Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 837

0 members and 837 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

Lorri (51)

» Stats

Members: 75,945
Threads: 249,146
Posts: 2,572,377
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 1 of 1

Threaded View

  1. #1
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    "Remove Boa, Python & Eunectes from H.R. 6311" petition

    Like the thread title says, a petition to remove Boa, Python & Eunectes from H.R. 6311 at iPetitions.com website.

    Figure since it is so relevant to our hobby we all out to do our part

    http://www.ipetitions.com/petition/u...311/index.html
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    juddb (11-14-2008)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1