Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 649

2 members and 647 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,904
Threads: 249,099
Posts: 2,572,073
Top Poster: JLC (31,651)
Welcome to our newest member, GeneticArtist
Results 1 to 9 of 9

Threaded View

  1. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Help Requested - ID Morph Super Form?

    Quote Originally Posted by rufretic View Post
    Maybe I misunderstood op but I thought the male parent is grey matter which I believe is champagne super cinny?
    Ah, then the error must be on my end. I thought GreyMatter was a SuperPewter Pied.

    If GM does have Champ then my bet is the animals in question are Champagne Calico Pewter. The Champ Pastel looks very similar upon hatching and the synergy of Calico wiping out pattern when combined with Pastel is also pretty common so stacking those three together I can see leading to a whitish snake
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    fatSNAKEs (08-16-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1