Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 747

1 members and 746 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,905
Threads: 249,104
Posts: 2,572,103
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 13

Threaded View

  1. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Does this look like a woma fire yellowbelly

    Quote Originally Posted by rufretic View Post
    On most enchi combos I agree with you but out of the enchi woma and super enchi womas I've seen, it doesn't seem to have that same yellowing effect, they stay more of a brown tan.
    Quote Originally Posted by rufretic View Post
    On this animal the pattern is just so reduced, I would think it had enchi if not super enchi. Because of its light color and blushed head stamp I do believe it has fire. What I'm not seeing is yellow belly. If it did have enchi and yellow belly, then I would think it would have more yellow coloring but yellow belly is a hard one for me.
    Quote Originally Posted by Godzilla78 View Post
    I concur. Definite super enchi woma with that awesome reduction!
    Quote Originally Posted by rufretic View Post
    What I'm not seeing is yellow belly. If it did have enchi and yellow belly, then I would think it would have more yellow coloring but yellow belly is a hard one for me.


    Rufretic, Godzilla,

    With respect, might I ask if either of you actually work with the Woma morph?

    I have been working with Woma for the past eleven years so I do kind of have an eye for things that they do when in combo.

    Most of the pics of Enchi Woma and SuperEnchi Woma are low-quality ones posted by one big breeders. His animals are not the norm.

    You both focus on how reduced the animal is. I have produced both single gene and combo Womas without any Enchi in them that are as reduced as that animal. YB when paired with Woma, in a somewhat contradiction to its normal behaviour in combos, tends to reduce the pattern and deepen the blacks on the animals. The bellies on WomaYB stay clean so they are nearly worthless in helping the ID.



    Dolo,

    Can you ask the breeder what the pairing was that made this animal? If there is no Enchi in either parent then there would be no point in continuing to argue about whether or not this is and Enchi Woma or SuperEnchi Woma.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Dolo (05-31-2019),rufretic (05-28-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1