Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 863

1 members and 862 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,903
Threads: 249,099
Posts: 2,572,071
Top Poster: JLC (31,651)
Welcome to our newest member, wkeith67
Results 1 to 10 of 14

Thread: Winter shipping

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Winter shipping

    Quote Originally Posted by MR Snakes View Post
    I have heard of this 40 hour heat pack but we routinely have overnight packages that don't make it here overnight (about 50%). So is 48 hours too long?
    FWIW there are 72hr heat packs available. I use these exclusively
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Godzilla78 (11-30-2018),MR Snakes (11-30-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1