Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 758

1 members and 757 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,121
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 22

Threaded View

  1. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: "Look but don't touch" animals?

    Quote Originally Posted by redshepherd View Post
    As for other species of snakes, there are definitely snakes that are never comfortable with handling, or they are very hard to work with to tame if they have a strong tendency to bite all the time, always get very stressed out, etc so it makes it not worth the effort anyway and is hard on the snake. Not all animals can become pets that you can eventually handle.
    ^^^^
    This


    I have a pair of kukri snakes. If you know how they got their name you will understand why they are not 'touchy-feely' animals. I also have a pair of Rhamphiophis, a little research into them should explain why I do not handle them overly much either.

    I did not pick up these species so I could hold them and play with them (I have ball pythons if I want to do that), I got them because I wanted something unique/different to work with. I knew I would not be handeling them and I was perfectly happy with that
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (09-11-2018),Bogertophis (09-11-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1