Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,208

0 members and 1,208 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,917
Threads: 249,118
Posts: 2,572,203
Top Poster: JLC (31,651)
Welcome to our newest member, Necbov
Results 1 to 10 of 17

Threaded View

  1. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    In my experience, the whitest snakes are pure white BlkELs, all-white Pied Lesser (but these have microphthalmia), and the White Wedding variant of Pied Spider.

    Every adult "white" BluEL I have seen has had a faint pigmentation to it so that it was more cream white or milk white rather than the stark, pure white of the previously mentioned.

    I also had a Ivory Butter Pastel that was quite white, but again, it was more a cream white than stark white
    Last edited by asplundii; 08-03-2017 at 09:17 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Charles8088 (08-03-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1