Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,114

0 members and 1,114 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,202
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 10 of 32

Threaded View

  1. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: How dangerous are these snakes to kids?

    Quote Originally Posted by nashveg View Post
    That being said, do I need to be there to supervise the kids with the snakes?
    2 words: HELL and YES!!

    My kids are used to walking up to me with big wolf spiders, big centipedes, assasin bugs, humongous slugs, and wild snakes in-hand. They're not afraid of much wildlife.
    When I was a kid I was just like your kids, walking around with everything I could get my hands on (caught my first snake when I was 4.) I was lucky, growing up where there was nothing of danger. Now that I have my own kid and living in a place where there are venomous snakes, she is not allowed to do any of the stupid things I did when I was a kid. I do not care if it is a ringneck snake she finds in the garden, if she wants to hold/touch it she has to come get me first. She is not allowed to get any of the snakes out on her own and she is never left alone with any of the snakes when they are out.

    Remember, SAFETY above all else.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    TheOtherLeadingBrand (07-13-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1