Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,356

0 members and 2,356 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,067
Threads: 249,217
Posts: 2,572,783
Top Poster: JLC (31,651)
Welcome to our newest member, Inky Clouds
Results 1 to 10 of 13

Threaded View

  1. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: New Ordinance passed lastnight in my city!!!!

    Quote Originally Posted by BLong7211 View Post
    But good nes is I don't live in the city! I live on the outskirts of the city but still in the same county so i have to see if it applies to me too! So wish me luck!!
    My advice to you is to not even bother asking questions cause it will draw attention to you.

    I had an acquaintance who learned that a certain species of kingsnake was not legal to own where he lived. He had a pet store king, bought while living in a different state, that looked similar to the local species but was indeed not the local species. He emailed the authorities with pics and the background of the animal to make sure he was above the board. The reply he got back was that, because his animal looked like the species in question it was illegal for him to own. And 2 days later he had F&W knocking on his door.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    BAD Morphs (05-27-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1