Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 676

0 members and 676 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,915
Threads: 249,118
Posts: 2,572,197
Top Poster: JLC (31,651)
Welcome to our newest member, KBFalconer
Page 1 of 2 12 LastLast
Results 1 to 10 of 17
  1. #1
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Honest opinions needed

    Okay, a little background here

    A couple years ago I purchased a pair of egg-eaters. They were relatively new to the world which meant they either had to eat finch eggs (not easy to get your hands on) or be tube fed. The seller was tube feeding them. I had sporadic access to finch eggs and I have tube fed before so I felt comfortable taking them on.

    Everything with them has been going well until recently. Over the last couple months I have begun to notice kinks popping up on them. And as the kinks have been popping up the locomotion on the animals has begun to deteriorate. Here are a couple vids from last night (please excuse the manic giggles of my 5 year old in the background), this is the female, she is the least impaired of the pair:

    http://s146.photobucket.com/albums/r...t=P2190009.flv

    http://s146.photobucket.com/albums/r...t=P2190010.flv

    http://s146.photobucket.com/albums/r...t=P2190011.flv


    I have my suspicions as to what might be the cause of this but that is rather moot at this time since it can not be undone.


    Anyways, my question to all of you (and please be brutally honest) is do I freeze them? My gut feeling is that I ought to but I want to be sure I am not just over reacting.

    Thanks in advance for your input.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #2
    BPnet Veteran Little B-Py's Avatar
    Join Date
    11-29-2008
    Location
    Nashville, TN
    Posts
    659
    Thanks
    82
    Thanked 25 Times in 24 Posts
    Images: 18

    Re: Honest opinions needed

    the videos didn't show...
    Steffen, pronounced with f's, not v's
    1.0 Normal BP, Oakley; 0.1 Normal BP, Hissy Fit; 1.0 Savannah Monitor, Abraxas, RIP 2-1-09; 0.0.1 Pacman Frog, Twoey; 1.0 BCI/BCC Cross, Quetzalcoatl "Q"; 0.0.1 Crestie - Flametail; 0.0.1 Crestie - Nuala; 0.1 Emp Scorpion - Black Arachnia; 0.1 ATB - Cortana; 0.0.1 Savvy - Lohe; 0.1 Colombian RTB, Queen Zida; 1.0 Common Boa; 0.0.1 Beardie

  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Honest opinions needed

    Try now
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #4
    Old enough to remember. Freakie_frog's Avatar
    Join Date
    08-12-2004
    Location
    221b Baker Street
    Posts
    16,636
    Thanks
    462
    Thanked 3,884 Times in 2,148 Posts
    Blog Entries
    2
    Images: 107

    Re: Honest opinions needed

    I am not familiar enough with this species to give any advice but I will say that it is very interesting..

    Please let up know how it turns out
    When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban
    "for the discerning collector"



  5. #5
    BPnet Veteran Little B-Py's Avatar
    Join Date
    11-29-2008
    Location
    Nashville, TN
    Posts
    659
    Thanks
    82
    Thanked 25 Times in 24 Posts
    Images: 18

    Re: Honest opinions needed

    They work now. I have no experience with them so this is interesting to me.
    Steffen, pronounced with f's, not v's
    1.0 Normal BP, Oakley; 0.1 Normal BP, Hissy Fit; 1.0 Savannah Monitor, Abraxas, RIP 2-1-09; 0.0.1 Pacman Frog, Twoey; 1.0 BCI/BCC Cross, Quetzalcoatl "Q"; 0.0.1 Crestie - Flametail; 0.0.1 Crestie - Nuala; 0.1 Emp Scorpion - Black Arachnia; 0.1 ATB - Cortana; 0.0.1 Savvy - Lohe; 0.1 Colombian RTB, Queen Zida; 1.0 Common Boa; 0.0.1 Beardie

  6. #6
    BPnet Royalty JLC's Avatar
    Join Date
    01-28-2004
    Location
    Alexandria, VA
    Posts
    31,651
    Thanks
    3,195
    Thanked 7,203 Times in 3,028 Posts
    Blog Entries
    37
    Images: 304

    Re: Honest opinions needed

    Oh man, that looks really sad. Have you taken them to a herp vet? I don't have any experience with this sort of thing, and you don't really give much info at all. It's impossible to say what should be done. Is there a chance the snakes could recover and live a normal, contented life? If so, is it worth it to you to try and rehabilitate them? Or are they doomed to a painful, slow deterioration? In the second vid, you can see how the other snake is just lying there belly-up for awhile, then oh-so-slowly manages to turn over.

    IF the condition is permanent, then I can't see any other humane option but euthanasia. Not sure if "throwing them in the freezer" is the right way to do that, though.
    -- Judy

  7. #7
    BPnet Veteran
    Join Date
    09-14-2007
    Location
    Northern Virginia
    Posts
    3,250
    Thanks
    170
    Thanked 703 Times in 538 Posts

    Re: Honest opinions needed

    Wow those videos are sad.

    It sounds to me like you believe this is happening due to a nutritional deficiency when they were young? Sometimes things like that can be at least partially corrected by proper diet and/or supplementation later. I know nothing about this species, so really the only thing I can recommend is to get them to a good herp vet.

    I'm curious about the other picture in your photobucket. It looks like a frog and a BP? What is going on in that picture??
    Casey

  8. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Honest opinions needed

    JLC,

    I have discussed this with my vet but he does not have any experience with egg-eaters either so he is kind of shooting from the hip as well. I am going to be meeting with him over the weekend for him to look at them hands on.

    What furthur info would you like? I am happy to provide.

    I am more than willing to work on rehabing them if they can recover, it is just that I am just afraid that the way that the condition seems to be deteriorating as time passes may mean it is not going to be "fixable".

    And yes I know "throwing them in the freezer" is not the right way to put a snake down. I was more using the phrase "freeze" as a euphamism for putting them down. If I need to put them down I'll have my vet do it.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Honest opinions needed

    Quote Originally Posted by kc261 View Post
    It sounds to me like you believe this is happening due to a nutritional deficiency when they were young?
    Actually, I think what is happening may be more akin to why you do not pop baby chondros. These guys have really fragile bones. I knew this and I have been extremely careful when feeding/handling them. I do not know how the seller was handling them though and if he was not as aware of the fragile nature of their bones it would be easy to overlook the fact that you can not "clamp down" on them to keep them still while tubing. I think they may have sustained damage early on and it is only now becoming apparent.

    I'm curious about the other picture in your photobucket. It looks like a frog and a BP? What is going on in that picture??
    That is not my pic. It is a screen shot from another forum. I captured it for a "bad person" thread on another site. I can provide further details via PM if you like.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #10
    BPnet Royalty JLC's Avatar
    Join Date
    01-28-2004
    Location
    Alexandria, VA
    Posts
    31,651
    Thanks
    3,195
    Thanked 7,203 Times in 3,028 Posts
    Blog Entries
    37
    Images: 304

    Re: Honest opinions needed

    Glad to hear all that! I imagine there aren't very many folks out there with much egg-eater experience, though.

    Info that might help puzzle out whether or not there is a chance for recovery:

    1. What do you THINK caused this? (You said you had an idea)

    2. When did you first notice evidence of something wrong?

    3. Did that something appear in both snakes at the same time? Or first one and then later the other?

    4. How fast have they "gone downhill" since you first noticed something wrong?

    5. How much worse is the second one than the one shown in the vids?

    6. What steps have you taken to try and correct the issue? (ie: extra feedings...calcium supplements...change in diet...medicines...change in environment?)

    7. Did your vet have any advice to offer at all? If so, what was it and were you able to follow it?

    8. Have you seen any signs of improvement at all that might indicate a chance to turn it around?

    I don't know if we have any resident "egg-eater experts" around...but hopefully someone will be able to help you come to a reasonable and humane decision.
    -- Judy

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1