Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,239

3 members and 1,236 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 2 of 5 FirstFirst 12345 LastLast
Results 11 to 20 of 42
  1. #11
    BPnet Senior Member anatess's Avatar
    Join Date
    11-13-2008
    Posts
    1,799
    Thanks
    133
    Thanked 502 Times in 311 Posts
    Images: 5

    Re: I'm Back...But Auryn's Missing.

    Quote Originally Posted by Nate View Post
    Hey there


    Welcome back!

    I think he will show up when and where you're least expecting it
    Hopefully, not in the neighbor's couch. Okay, bad joke. Thought I'd throw a little humor from that story of a boa found in Brooklyn.

    Snake's probably still in your room when you get back. Let us know how it goes.
    ----------------------------------
    BP owner since Oct 2008, so yeah, I'm no expert.
    0.1.0 pastel bp
    1.0.0 spider bp
    0.1.0 albino bp
    1.0.0 bumblebee bp
    1.0.0 yellowbelly bp
    0.0.1 normal bp
    1.0.0 normal western hognose


    Life should NOT be a journey to the grave with the intention of arriving safely in an attractive and well preserved body, but rather to skid in sideways, chocolate in one hand, body thoroughly used up, totally worn out and screaming "WOO HOO what a ride!"

  2. #12
    Registered User
    Join Date
    02-18-2009
    Posts
    6
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: I'm Back...But Auryn's Missing.

    I had the same thing happen, I forgot to re-latch completely and the next morning one of my babies had run away. I spent the entire day looking for her, the ENTIRE day. I checked behind the books on the bookcases, in my computer towers, in the futon, in the clothes in the closet just incase she somehow found a way into a pair of jeans or a jacket, I mean everywhere. Everywhere except a foam basket that was within 1ft away from her enclosure. I was working a few days later and heard a rustling, pinpointed that basket and just shook my head saying, "No freaking way." Well, to my embarrassment, there she was, not even a foot away from her enclosure.

    Be persistent, I have read that if you get a shoe box and place a dead rodent in there, the smell will attract your lost snake. Simply cut a hole thats large enough for Auryn to enter, but not exit once she's eaten. I never tried that, so don't quote me!

    Check everywhere, even the dumbest place that you'd never think she'd go.

    Do you keep the door closed to that room when you aren't in there?

  3. #13
    BPnet Royalty JLC's Avatar
    Join Date
    01-28-2004
    Location
    Alexandria, VA
    Posts
    31,651
    Thanks
    3,195
    Thanked 7,203 Times in 3,028 Posts
    Blog Entries
    37
    Images: 304

    Re: I'm Back...But Auryn's Missing.

    SO nice to see you back! I know that panicky feeling. Kisasa escaped twice on me. First time, I found her in a deep closet on the other side of the house, behind some boxes in the very back. ("Flashlight" is your best friend! LOL) I tell ya, I never realized how many tiny, dark, unreachable (by me!) places my home had until she escaped and I had to find her! I was very glad all I had to do was move a bunch of boxes. The second time, I could hear her moving and found her slithering behind some stuff against the wall.

    It's unlikely you'll just see him slithering across the middle of a room...but follow along the walls....look for any "trails of destruction" (stuff knocked over or moved out of place) to help determine which direction he might have gone. Make the home as quiet as possible and just sit silently and listen. Try to think like he does...warm, quiet, dark, tight. And don't dismiss any hole, opening, crack, crevice etc that you think is "too small" for him to have fit through.

    I'm sure you'll find him! And I don't think one day in a cool room will do him any harm!
    -- Judy

  4. #14
    Steel Magnolia rabernet's Avatar
    Join Date
    07-12-2005
    Location
    In the Nest
    Posts
    29,196
    Thanks
    2,845
    Thanked 5,584 Times in 3,092 Posts
    Blog Entries
    2
    Images: 46

    Re: I'm Back...But Auryn's Missing.

    Kim!!!

    I really can't add much to the other good information shared already, but it's great to see you and PLEASE post when you find him!

  5. #15
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6

    Re: I'm Back...But Auryn's Missing.

    Nice to see you back Kim, sorry Auryn is missing and I hope you will be able to find him.

    Look for dark small cramp places, laundry basket, behind dressers, in drawers etc.

    Good luck on finding him!
    Deborah Stewart


  6. #16
    Registered User JeffJ's Avatar
    Join Date
    02-13-2009
    Location
    London, Canada
    Posts
    1,039
    Thanks
    74
    Thanked 127 Times in 113 Posts
    Images: 3

    Re: I'm Back...But Auryn's Missing.

    My lil guy escaped when i first got him. thankfully he just coiled up on top of the screen around the latch and sat there.

    to the petstore for some clips i went, i have since moved on yo a bigger enclosure that is secure. and since my girlfriends younger nephews come by to be baby say and the little girl next door comes to play with them i have it under lock and key that requires you to lock it with the key to close it properly helps let me remember.
    1.0 Ball Python: Monty
    0.1 Red Tail boa: Dixie
    0.1 Tree Boa: Carmen

  7. #17
    Registered User XGetSome's Avatar
    Join Date
    10-25-2008
    Location
    Ridgecrest, California...Gateway to Death Valley!
    Posts
    272
    Thanks
    45
    Thanked 62 Times in 49 Posts

    Re: I'm Back...But Auryn's Missing.

    Sorry bout your luck Kim,

    About 8 Years ago I lost a ball python, took 4 or 5 months to find him, he was in a folder in my filing cabinet...He was alive and well.....oh the funy thing about it, was the filing cabinet was the stand for his cage....lol

    Good Luck Kim

  8. #18
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: I'm Back...But Auryn's Missing.

    Quote Originally Posted by JLC View Post
    It's unlikely you'll just see him slithering across the middle of a room...but follow along the walls....
    Never tried this myself but I have heard that pouring corn meal along the base boards can be helpful, give you an idea of where he may have passed...

    Only escapee I ever had turned up at the toilet. Guess he wanted water...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #19
    BPnet Veteran Exotic Ectotherms's Avatar
    Join Date
    12-29-2008
    Location
    South Jersey
    Posts
    787
    Thanks
    607
    Thanked 185 Times in 147 Posts
    Images: 19

    Re: I'm Back...But Auryn's Missing.

    As mentioned by others, check UNDER refrigerators. Its amazing that they can fit under them, but they do it. I never realized how nice and warm it is under there until I checked for myself.

  10. #20
    BPnet Veteran PythonWallace's Avatar
    Join Date
    02-26-2007
    Location
    Woodridge, IL
    Posts
    2,967
    Thanks
    204
    Thanked 346 Times in 210 Posts
    Images: 23

    Re: I'm Back...But Auryn's Missing.

    Welcome back. Sorry to hear about Auren. I've had a young bp escape and after I searched everywhere with no luck, I started listening for him. Whenever I was reading or watching T.V. or anything, I kept an ear out and any time I heard anything I ran to see if it was him. Eventually I heard a noise in my kitchen and ran to check and I found him wrapped in the window blinds. Good luck finding him and getting him eating again.
    What are these mojavas I keep hearing so much about?

    J. W. Exotics

    Reptile Incubators

Page 2 of 5 FirstFirst 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1