» Site Navigation
0 members and 744 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
|
-
Registered User
Re: woma lessers
wow they are beautiful
-
-
BPnet Veteran
-
-
Re: woma lessers
 Originally Posted by nelson77321
you need hidden gene from both parents for a soul sucker. so you need a hidden gene carrier woma and a hidden gene carrier lesser.
I do not think that is accurate.
I could be wrong on this but IIRC the belief now is that the "hidden" gene is just another allele in the white snake (lesser/mojave/butter/Russo/Phantom/etc) complex. And, as such, if an animal had 2 copies of the "hidden" allele it would not be able to carry the lesser allele. So, basically, a SoulSucker is a Platinum (or PlattyDaddy to use Ralph's term) woma
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: woma lessers
 Originally Posted by asplundii
I do not think that is accurate.
I could be wrong on this but IIRC the belief now is that the "hidden" gene is just another allele in the white snake (lesser/mojave/butter/Russo/Phantom/etc) complex. And, as such, if an animal had 2 copies of the "hidden" allele it would not be able to carry the lesser allele. So, basically, a SoulSucker is a Platinum (or PlattyDaddy to use Ralph's term) woma
But I just wanna make a regular lesser x woma (http://www.newenglandreptile.com/ner...ll-python.html) I mean soul suckers are great, but its not like I'll ever be able to afford the 4,500$ price tag just for the woma, and on top of that the soul suckers themselves are like 20,000$. So again, could I just do it w/ a regular woma and lesser or would I still need the "hidden gene"?
-
-
Re: woma lessers
If you want to make just a regular (and I use the term loosely) woma x lesser then you do not need the "hidden" gene. Only need the "hidden" for a SoulSucker.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: woma lessers
Here's a picture from Exotics by Nature's site of a regular, non-hidden gene woma x lesser cross:
http://www.exoticsbynature.com/daytona06/bhb21.jpg
There's also been some mojave x woma crosses produced that look similar. As far as I know, the only one who's produced any combos with that hidden gene expressed has been NERD.
Also, the hidden gene in the woma is different from the one that is in platinums. If they were the same I would have expected to see platinums popping up in NERDs clutches as well.
Last edited by Stewart_Reptiles; 02-06-2009 at 12:03 PM.
Reason: NO hotlink!
-
-
Re: woma lessers
 Originally Posted by jluman
Also, the hidden gene in the woma is different from the one that is in platinums. If they were the same I would have expected to see platinums popping up in NERDs clutches as well.
I do not know that it is certain they are not the same. I thought I heard somewhere Kevin speculated they were the same (could easily be mistaken on that though.) Also, the absence of evidence is not necessarily evidence of absence... NERD may have just missed making a platty in their breeding of "hidden" gene woma x lesser. After all, it is possible to breed 100% hets and not get a visual for 2 or 3 or 4 years... Or maybe NERD has made platty's and they just are not talking about it...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: woma lessers
 Originally Posted by asplundii
I do not think that is accurate.
I could be wrong on this but IIRC the belief now is that the "hidden" gene is just another allele in the white snake (lesser/mojave/butter/Russo/Phantom/etc) complex. And, as such, if an animal had 2 copies of the "hidden" allele it would not be able to carry the lesser allele. So, basically, a SoulSucker is a Platinum (or PlattyDaddy to use Ralph's term) woma
its a hidden gene in the woma's not the lessers that causes the soul sucker. but in order to get that you need to breed hidde gene woma x lesser. then hold the off spring back to breed for the soul sucker.
ive got this info from a reliable source, who owns the only other soul sucker outside of NERD.
-
-
Re: woma lessers
 Originally Posted by nelson77321
its a hidden gene in the woma's not the lessers that causes the soul sucker. but in order to get that you need to breed hidde gene woma x lesser. then hold the off spring back to breed for the soul sucker.
ive got this info from a reliable source, who owns the only other soul sucker outside of NERD.
I did not say the "hidden" gene was in the lesser. What I said was that the "hidden" gene that is in NERD's woma is the same (or very near the same) as the "hidden" gene that is in RDRs "daddy" animals and that from what I recalled the consensus was that this gene is an allele to the others in the white snake complex.
And the means by which you say you have to breed to get a SoulSucker are not mutually exclusive from what I have said. There is more than one way to skin a cat after all
Plus, I have said no less than 6 times that I am not 100% on anything I am saying. I am speculating based on the information that is available, which is really all any of us can do because the fact of the matter is that no one really knows what is going on with the "hidden" gene (or genes if you think there are more than one of them). It is all still work in progress. I know what I would like to see done that I think would settle the matter but I am not presumptuous enough to email Ralph and tell him what I think he ought to do. But until it does get done we are all just playing a guessing game.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: woma lessers
I don't know anything about the woma "hidden" gene, but I thought I would clear up that a Pearl is a super woma. And they are fatal. For some reason they just don't survive long. But a Peral has is just from a woma x woma.
I wonder if the "hidden" gene would help the pearl survive...
~ Shannon
1.2 normal bp ~ Lilly (06) ~ Delilah (09) ~ Joey (06)
1.0 cinnamon bp ~ Doughnut (08)
1.0 mojave bp ~ Jay (08)
0.1 pastel bp ~ Patsy (09)
2.0 cats ~ Lil Bit (08) ~ Toby (08)
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|