» Site Navigation
1 members and 726 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,104
Posts: 2,572,103
Top Poster: JLC (31,651)
|
-
Registered User
Question!!what small bugs in empty water dish
Question!! what kind of small bugs in empty water dish(wood bark is floor is it termites?) thanks
-
-
BPnet Veteran
Re: Question!!what small bugs in empty water dish
Sounds like it could be mites. Can you get us a good picture of them, and the snake?
-
The Following 2 Users Say Thank You to stangs13 For This Useful Post:
BallPythons9 (01-16-2009),echo0587 (01-16-2009)
-
BPnet Veteran
Re: Question!!what small bugs in empty water dish
If you have no mites on the snake (when you pick it up, they should be on your hand (depending on severity of infestation)...they could be wood mites.
These are not reputed to be dangerous to the snake. They usually die in the waterdish, but don't live on the snake.
"Price has very little to do with QUALITY. Quality stands on its own merit and doesn't need a hefty price tag to prove its worth."
-
The Following User Says Thank You to broadude For This Useful Post:
-
BPnet Veteran
Re: Question!!what small bugs in empty water dish
This is why i recomend that people dont use bark for a substrate, you most likely have wood mites. i would ditch the bark, treat the tank and snake for mites and change your substrate over to aspen.
~MIKE~
You:How many snakes do you have?
Me: Oh, just a room full.
You:Eh, how many?
Me:A ROOM FULL.
-
-
BPnet Veteran
Re: Question!!what small bugs in empty water dish
More than likely mites. Time to order sam PAM. Prevent-A-Mite. You'll probably only need to useit once, but it's totally worth the money.
I hear the shelf life is outstanding.
1.0.0 Normal BP: Vincent Vega
-
-
BPnet Veteran
Re: Question!!what small bugs in empty water dish
On a side note, why is the water bowl empty? Got a REALLY thirsty snake? LOL
-
-
BPnet Veteran
Re: Question!!what small bugs in empty water dish
if they are not black or really dark brown they are not snake mites
wood mites are aspen colored
-
The Following User Says Thank You to nixer For This Useful Post:
-
Re: Question!!what small bugs in empty water dish
I am more inclined to believe they are spring tails. Rather common in organic/wood mulches and they have a prediliction for congregating around water. Totally harmless.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Question!!what small bugs in empty water dish
 Originally Posted by hawaiianice99
This is why i recomend that people dont use bark for a substrate, you most likely have wood mites. i would ditch the bark, treat the tank and snake for mites and change your substrate over to aspen.
wood mites dont only come in bark.
-
The Following User Says Thank You to nixer For This Useful Post:
-
BPnet Veteran
Re: Question!!what small bugs in empty water dish
 Originally Posted by asplundii
I am more inclined to believe they are spring tails. Rather common in organic/wood mulches and they have a prediliction for congregating around water. Totally harmless.
You're going to say this and you don't know what he's talking about? I don't see a picture here,maybe because i'm at work. But saying "it's totally harmless" is the wrong way to go.
At least get a can of PAM, it can't hurt. (unless you use it wrong) And will probably kill whatever it is.
1.0.0 Normal BP: Vincent Vega
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|