» Site Navigation
0 members and 859 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,107
Posts: 2,572,121
Top Poster: JLC (31,651)
|
-
Re: Repticon - Gwinnett Fair Ground - The pictures
Well, the show was fun. On the pic Deborah payback is a .......
See the problem with me and these shows.... I sell stufff... I make money... but then I always end up buying much more then I sell!!! Have to unpack, so picks to come soon....
My pickups:
* Georgeous Albino Female Ball Python (purchased from BA Reptiles, produced by Michael Cole)
* 2 crested geckos and setup (yes Deborah, 2. thanks for twisting my arm)
* RBI 16 tub hatchling rack
* A bunch of normal frozen rats (for my redtail)
All in all it was a lot of fun! Great seeing everyone again, and meeting some new folks too. Give DSGB a couple days on those pictures!!!! the snake he got from me is in total BLUE! Here is what he normally looks like:

Mikey Cavanaugh
(904) 318-3333
-
-
Re: Repticon - Gwinnett Fair Ground - The pictures
Well, the show was fun. On the pic Deborah payback is a .......
Seems like next time I am gonna have a bnch of people ganging up on me.
* 2 crested geckos and setup (yes Deborah, 2. thanks for twisting my arm)
Guilty as charged but I really did not have to twist your arm much now how about some pics of those cuties?
<-----------See my new custom title The Enabler
-
-
-
-
BPnet Veteran
Re: Repticon - Gwinnett Fair Ground - The pictures
really nice pics !!! seems like it was a nice show ! question: what setting do you use for taking pics at shows ? espically if they are in the containers...i use flash, get the flash in my pic, without flash pic comes out blurry....no winning !
-
-
BPnet Veteran
Re: Repticon - Gwinnett Fair Ground - The pictures
 Originally Posted by asplundii
Might as well add my pics

was this a normal ? how much ?! That BP has an amazing pattern !!! that would have been a pick up for my collection !
-
-
Re: Repticon - Gwinnett Fair Ground - The pictures
 Originally Posted by patb201985
really nice pics !!! seems like it was a nice show ! question: what setting do you use for taking pics at shows ? espically if they are in the containers...i use flash, get the flash in my pic, without flash pic comes out blurry....no winning !
Personally I use the same setting than I do when taking pics of my collection at home.
Natural light
Indoor setting
And of course the use a macro or super macro depending on the case.
-
-
BPnet Veteran
Re: Repticon - Gwinnett Fair Ground - The pictures
that green tree monitor was SICK!
-
-
BPnet Veteran
Re: Repticon - Gwinnett Fair Ground - The pictures
 Originally Posted by Deborah
Personally I use the same setting than I do when taking pics of my collection at home.
Natural light
Indoor setting
And of course the use a macro or super macro depending on the case.
#1. check
#2. check
#3. n/a ! lol got to get me one of those nice macro lens !
thanks
-
-
Re: Repticon - Gwinnett Fair Ground - The pictures
 Originally Posted by patb201985
question: what setting do you use for taking pics at shows ? espically if they are in the containers...i use flash, get the flash in my pic, without flash pic comes out blurry....no winning !
I just used the standard settings on my camera. Was not really in the mood to dink with everything. Some of the shots had flash and some didn't. The light there was not that bad so it was not a great challenge taking pics.
Seller called it a Harlequin
It was $50 IIRC
That BP has an amazing pattern !!! that would have been a pick up for my collection!
I really liked the pattern too. I just do not have any more room or I would have taken it.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|