OK theres my lil girl Morrigu's Question mark ... and all the pics are pretty impressive!
Originally Posted by Mike Cavanaugh this should have been a contest! I have a naked stripper on one of my balls.... i hope you used protection
Now I'm gonna have to inspect our BP a bit more... neat stuff. Never thought to look at them this way.
this should definatly be turned into a contest!!!!
all my girl has is a spot that looks like a doughnut.
An alien version of George W Bush:
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Originally Posted by asplundii An alien version of George W Bush: BEAUTIFULL snake!!!!!! but i cant say i see the alien bush
Forum Rules
Reply With Quote
Originally Posted by Mike Cavanaugh
