» Site Navigation
0 members and 395 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,086
Threads: 249,226
Posts: 2,572,838
Top Poster: JLC (31,651)
Welcome to our newest member, diingoo
|
-
Registered User
Re: about to make the dreadful switch :tears:
 Originally Posted by SnM_Man
im fairly new to BP husbandry aswell ... and after seeing some pics of half eaten snakes ... i will never ever leave a live prey in a cage unsupervised ... and also to note that u should feed ur live mice/rats cat or dog food, it contain a food colouring agent that is poisonous ... i forget the name of it but im sure someone else does.
If it is poisonous to mice, then it would likely be poisonous to dogs and cats as well.
-
-
-
-
Registered User
Re: about to make the dreadful switch :tears:
 Originally Posted by Typical_08
If it is poisonous to mice, then it would likely be poisonous to dogs and cats as well.
i miss typed ... its fine for the mice but really bad for the snake !!
-
-
BPnet Veteran
Re: about to make the dreadful switch :tears:
 Originally Posted by SnM_Man
how can u condone feedin in the tank ??... if u have loose substrate u run the risk of impaction
its not nessecerly whats best for the snake ... but how big my wallet is  ..... but shes in a 10 gallon glass tank- with 2 hides n good size water dish - ... shes only maybe 24'' long now, im planing on making a custom enclosure in the near future.
What? No way. I feed both snakes live, in the tank, with aspen. Never a problem. Rat bones are way tougher than some aspen substrate. I don't think this would ever be an issue if you use the right substrate.
1.0.0 Normal BP: Vincent Vega
-
-
Re: about to make the dreadful switch :tears:
 Originally Posted by SnM_Man
im fairly new to BP husbandry aswell ... and after seeing some pics of half eaten snakes ... i will never ever leave a live prey in a cage unsupervised ... and also to note that u should feed ur live mice/rats cat or dog food, it contain a food colouring agent that is poisonous ... i forget the name of it but im sure someone else does.
With the feeding response of my snakes, the mouse wouldn't get a chance to eat the kibble. Given the choice between the mouse eating kibble or eating the snake, I'd choose kibble. If your snake hasn't eaten him before he has a chance to hunker down and eat the kibble, he's not going to eat him anyway.
The pictures that you've seen of half eaten snakes are from a keeper leaving a rodent in the enclosure for DAYS at a time, not from a normal live feeding. The anti-live supporters often use them to sensationalize why you shouldn't feed live. A rodent being constricted isn't able to do the damage that is shown in those pictures while it's gasping to take a breath. That's more of an FYI - those pictures horrified me as well - until I was told the true story behind them. Well, it's still horrifying, but not a result of someone feeding their snake live, but rather as a result of irresponsible snake keeping.
-
The Following User Says Thank You to rabernet For This Useful Post:
-
Re: about to make the dreadful switch :tears:
So true Robin.
My hypo has already caught and constricted the mouse before I even get the tub drawer closed!!! (That's where pre-scenting works wonders; she knows what's coming )
~~ McKinsey~~
"Men have forgotten this truth," said the fox. "But you must not forget it. You become responsible, forever, for what you have tamed."
~The Little Prince; Antoine de Saint Exupery
-
-
Registered User
Re: about to make the dreadful switch :tears:
 Originally Posted by Skoalbasher
What? No way. I feed both snakes live, in the tank, with aspen. Never a problem. Rat bones are way tougher than some aspen substrate. I don't think this would ever be an issue if you use the right substrate.
ya but the bones come in a wrapped up package that is fairly well stream lined ... and once the prey item makes it to the stomach they remain there untill fully digested ...a random chunck of aspen travelling down the snakes digestive track with its jagged edges could most definatly get caught up and cause some serious side effects ....
-
-
Re: about to make the dreadful switch :tears:
Here are some tips to feed live
Pre-scent the room
Supervise feeding
Feed smaller preys, feeding a small rats (4 weeks old – 65-85 grams) not only is enough for an adult but it will also reduce the risk of injury
Remove the prey if not eaten within 20 minutes.
Do not stun or abuse the prey prior to feeding (This is pretty common sense but obviously not for everyone )
I feed over live 150 preys each months and none of my snakes ever sustained any injury.
-
-
Re: about to make the dreadful switch :tears:
 Originally Posted by rabernet
There is no one in the wild making sure that snakes aren't consuming leaf litter and twigs.
Thank you for making that point and saving me from having to.
I have fed many many snakes over the years on cypress and eco-earth/peat mixes and they are more than capable of ingesting and passing a small amount of the stuff. It would take a huge amount of eco-earth to cause an impaction, significantly more than the very minor amount that may accidentally be taken up by a mis-strike.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: about to make the dreadful switch :tears:
 Originally Posted by SnM_Man
ya but the bones come in a wrapped up package that is fairly well stream lined ... and once the prey item makes it to the stomach they remain there untill fully digested ...a random chunck of aspen travelling down the snakes digestive track with its jagged edges could most definatly get caught up and cause some serious side effects ....
You're overthinking things. First, I'm not sure what type of aspen you're using, but none of the kind I've every used has had random chunks in them. Secondly, breeders have been feeding on cypress mulch (that DOES have chunks in them) for YEARS with no ill effects. Can you name anyone who has actually had an injury as a result of feeding on substrate?
My point is - people sensationalize "what if" scenarios, and yet no one seems to know first hand someone that it's happened to.
If F/T is more convenient for you - then use F/T.
The people responding here are giving you common sense answers to your other options and shared their REAL LIFE experiences doing so. I've fed over 4000 live prey items in the last 4 years to multiple snakes, on many different types of bedding. I've not had a single injury, I've not had any impactions, no one has keeled over from eating a rodent that may have chowed down on dog kibble.
Fearing the worst outcome, when the best outcome is your more likely outcome seems exhausting to me.
-
The Following 4 Users Say Thank You to rabernet For This Useful Post:
hoax (01-08-2009),Melicious (01-07-2009),vgibbens (01-07-2009),wax32 (01-07-2009)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|