» Site Navigation
3 members and 643 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: Is there a way to tell het pied on appearance?
 Originally Posted by Dragnbaron
Hmm, i guess my question sparked some debate. This is great stuff to learn, though! So pied is not really recessive and not really co dominant? (drawing some squares as i type)
The Pied gene is a RECESSIVE gene. Some animals, just seem to display similar traits with the "Belly pattern" But it is NOT a surefire thing to go by, as NORMALS have it too. It is part of the ball pythons pattern scheme. Animals het for other things, can also have the same markings.
-
-
Re: Is there a way to tell het pied on appearance?
Who here has produced a lot of het and possible het Pieds? I have. And there is a definite difference. It's not just about stripes on the sides of the belly. There is a little more to it. Not all hets have the marker, but when a possible het does, you can pretty much bet on it. EVERY het Pied I have ever produced has the marker and about 50% of the possible hets as well......even my pastel hets.
Why else would the largest producer of Pieds in the world keep his possible hets and sell his 100% hets? Could there be something to it?
-
-
Re: Is there a way to tell het pied on appearance?
Like I've said in the past.... I wish there were no het pied markers...
My 2008 pied-related project outcomes:
Pied X Poss het Pied with striped belly = 2 pieds
Pied X Poss het Pied with striped belly = 1 pied
Pied X Het Pied with striped belly = 5 pieds
YB Het Pied with striped belly X Het Pied with striped belly = 1 yb pied
YB Het Pied with striped belly X Het Pied with striped belly = 1 pied
I also produced approximately twenty 100% het pieds produced this year. Only 2 did not have STRONG markers... but they still have "the look"
Justin
http://www.ball-pythons.net/forums/s...ht=pied&page=2
-
-
Registered User
Re: Is there a way to tell het pied on appearance?
 Originally Posted by ch312
so, whats the marker?
Here is a pic of the het pied belly marker. It's the clean belly with black striped borders usually more prominent near the tail.
Anyone who has hatched out more then a few het pieds will tell you there is a very reliable marker. People who are either buying or selling possible hets will tell you that not all of them have it or some do and some don't. I use to say/think the same thing. Now that I've hatched over 100 hets with each and every single one having the marker my opinion is different. The only possible het pieds I've proved out have the marker, the ones without it never proved. Do I think there are het pieds out there that don't have the marker? Sure, but I'd say it's probably 1% or less of all the hets produced. This doesn't mean if you have a wild caught female with the marker that she is a het, believe me I've tried. But if you're buying hets or possible hets you can use the marker as a very reliable tool. If I knew this info when I was buying possible hets 5-6 years back, I would never buy one without the marker unless paying the price of a normal or very close to it. Even then I don't think I'd touch them.
Eric
-
The Following User Says Thank You to Eric Sandoval For This Useful Post:
-
Re: Is there a way to tell het pied on appearance?
Allow me to get somewhat hypothetical.
Has anyone considered the possibility that the "marker" trait has inadvertently been selected for but in and of itself is not actually a product of the actual pied allele??
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Is there a way to tell het pied on appearance?
 Originally Posted by asplundii
Allow me to get somewhat hypothetical.
Has anyone considered the possibility that the "marker" trait has inadvertently been selected for but in and of itself is not actually a product of the actual pied allele??
I think that the marker trait is a product of the pied, but I feel that it is a trait that is not always shared visualy. I am not claiming that many normals dont share these traits, sellers sometimes claiming that they are hets. But in my opinion what it comes down to is, only buying a het from a trustable breeder.
Last edited by MDB; 12-11-2008 at 10:39 AM.
-
-
BPnet Veteran
Re: Is there a way to tell het pied on appearance?
 Originally Posted by MDB
I have and still do, as said a million times before some have it and some dont. But I feel like alot of people swear by these markers. 
LOL i think its because they dont factor in that is part of the Wild Type Make up. " we see hundreds of het pieds with this marker"
yeah... Ive got/had normals with the same darn marker too, and a het pied without them!!!!
-
-
Registered User
Re: Is there a way to tell het pied on appearance?
-
-
BPnet Veteran
Re: Is there a way to tell het pied on appearance?
-
-
Re: Is there a way to tell het pied on appearance?
 Originally Posted by MDB
I think that the marker trait is a product of the pied, but I feel that it is a trait that is not always shared visualy. I am not claiming that many normals dont share these traits, sellers sometimes claiming that they are hets. But in my opinion what it comes down to is, only buying a het from a trustable breeder.
To me, if the marker was a product of the allele then there should be a 1:1 correlation which we do not have. However, if it is a case of linkage from inadvertent selective breeding that explains why you still get the 100% hets who look normal.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|