» Site Navigation
0 members and 641 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,909
Threads: 249,113
Posts: 2,572,174
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: BP hybrids?
there was a wall and carpall on ks like 2 days ago
ball+woma=wall http://market.kingsnake.com/detail.php?cat=7&de=649307
jungle carpet python+ball=carpall
Last edited by nixer; 12-10-2008 at 09:27 AM.
Reason: added a link
-
-
Re: BP hybrids?
the ball has been crossed with the short tail making superballs which have then been bred back to a ball making mongrels. roussis sells them. i haven't herd of anyone doing a blood ball cross.
i think the super dwarf X ball would work if the blood ball works. full adult bloods are pretty big so???
if you are into hybrids there is a forum for them called hybridhaven.net. its kinda cool but there is not alot of activity. the best hybrid IMO is the carphondroXGTP. they look amazing!
-
-
Banned
Re: BP hybrids?
 Originally Posted by Lucas339
i think the super dwarf X ball would work if the blood ball works. full adult bloods are pretty big so???
I wouldn't think it would work too well. Even though Super Dwarves are smaller than any other Retic, there is still a vast majority of developmental differences between the two, such as girth. Bloods and Balls share a similar girth, body shape, and development....where as Retics and Balls don't. This is one of the reasons the Retic x Burm, and Burm x Ball have been so difficult. I'd think Amethystine x Retic would work much better.
-
-
Re: BP hybrids?
I have noticed that one hybrid is missing from the list thus far into the thread. The Angolan x Ball. I realize this is not as much of a stretch for the simple fact that their natural ranges do cross, but it is still a hybrid. It's been awhile since I have seen one, but they were done a number of years ago. This hybrid I find the most unsettling, as the captive population of Angolans is still not that great, and I don't know why you would want to "muddy" the Angolans at htis stage of their population.
Just my .02 cents.
-
-
Registered User
Re: BP hybrids?
the link is down for the ball x woma...i really wanted to see it
-
-
Re: BP hybrids?
 Originally Posted by boost3d05
the link is down for the ball x woma...i really wanted to see it
Try here:
http://www.moreliapythons.com/forums...highlight=wall
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: BP hybrids?
richard pointed out the angry balls
and you have to be a member to view the photos from that link.
-
-
Re: BP hybrids?
 Originally Posted by Lucas339
and you have to be a member to view the photos from that link.
Sorry, my bad
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: BP hybrids?
 Originally Posted by muddoc
I have noticed that one hybrid is missing from the list thus far into the thread. The Angolan x Ball. I realize this is not as much of a stretch for the simple fact that their natural ranges do cross, but it is still a hybrid. It's been awhile since I have seen one, but they were done a number of years ago. This hybrid I find the most unsettling, as the captive population of Angolans is still not that great, and I don't know why you would want to "muddy" the Angolans at htis stage of their population.
Just my .02 cents.
Good point there Money Bags, Angolans are hard to come and now that people are crosses them at this point is ridiculous.
-
-
Registered User
Re: BP hybrids?
my godd thats amazing! Imagine what it would look like now crossed back to say a spider or a lesser that would be awesome to see, I think lol.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|