» Site Navigation
2 members and 700 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,118
Posts: 2,572,194
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
BPnet Veteran
Superstripe questions
Hey I was just curious what exactly is used to create a superstripe? Yb and G-strpe?
http://market.kingsnake.com/detail.php?cat=32&de=646417
-
-
Re: Superstripe questions
I could be mistaken but I believe it is its own unique genetic morph...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Superstripe questions
Specter( or spector?) and yb make the ss
- Matt
Come here little guy. You're awfully cute and fluffy but unfortunately for you, you're made of meat
-
-
Registered User
Re: Superstripe questions
 Originally Posted by Beardedragon
Specter( or spector?)
Do you have a link to a pic of a Specter?
-
-
BPnet Veteran
Re: Superstripe questions
 Originally Posted by Mischke
Do you have a link to a pic of a Specter?
http://www.ball-pythons.net/forums/s...ad.php?t=79740
sorry my pics are not great
-
-
Re: Superstripe questions
There are some pictures of my Specter/Whirlwind/Het Super Stripe in this thread. http://www.ball-pythons.net/forums/s...ad.php?t=75013
 Originally Posted by nixer
Like you said not great pictures but it looks right to me.
-
-
Registered User
Re: Superstripe questions
So Specter is the het form of a co-dominate mutation, with the super form being a Super Strip?
-
-
Re: Superstripe questions
 Originally Posted by Mischke
So Specter is the het form of a co-dominate mutation, with the super form being a Super Strip?
Close, but not quite. The specter IS the het form of something, but there hasn't been a super form proven. The Super Stripe is actually a combo of the specter and a yellow belly.
-
-
BPnet Veteran
Re: Superstripe questions
 Originally Posted by m00kfu
Close, but not quite. The specter IS the het form of something, but there hasn't been a super form proven. The Super Stripe is actually a combo of the specter and a yellow belly.
Quite right. Also discovered this year that the Super Stripe cannot reproduce itself 1 in 4 when bred to a normal -- only Specters and Y.B.
Specter and Y.B. stock has gone up!!!
-
-
BPnet Veteran
Re: Superstripe questions
 Originally Posted by Bill Buchman
Quite right. Also discovered this year that the Super Stripe cannot reproduce itself 1 in 4 when bred to a normal -- only Specters and Y.B.
Specter and Y.B. stock has gone up!!! 
Interesting - that means that the yb and specter are the same gene or allele. Pretty cool - we have a new gene complex to work with.......
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|