Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 786

0 members and 786 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 1 of 2 12 LastLast
Results 1 to 10 of 11
  1. #1
    BPnet Veteran
    Join Date
    06-23-2005
    Location
    Montreal, Canada
    Posts
    343
    Thanks
    81
    Thanked 54 Times in 41 Posts

    Genetic dilema ...

    On others website, the same question keep getting back and looks like no one know the answer.

    so here it is

    Mojave X mojave "lucy" bred to a normal will give you what?
    Lesser X mojave lucy when bred to a normal will give you what?

  2. #2
    BPnet Veteran
    Join Date
    06-23-2005
    Location
    Montreal, Canada
    Posts
    343
    Thanks
    81
    Thanked 54 Times in 41 Posts

    Re: Genetic dilema ...

    Here is my hypothesis and result

    Would it be possible that the lesser and the mojave are just 2 different gene on the same allele ?

    They can be 2 different version of the same gene. Or one is a mutation of the other one.

    Let say
    Mojave are on the 10th allele (loci)
    Lesser are also on the 10th allele
    Butter are also on the 10th allele
    while
    pastel reside on the 15th allele
    albino on the 6th allele
    piedball on the 22th allele

    I hope you understand what I am trying to say.

    May be the mojave and the lesser aren't 2 different gene, they are just a different mutation of the same gene. Meaning they reside on the same allele. So having 2 of these (mojaveXlesser or mojaveXmojave or lesserXlesser), will produce a kind of blue eye lucy. The only difference would be that the lesser make the snake all white, while the mojave doesn't make them all white.


    It's just a hypothesis, don't think it can be proved without blood test of some kind.

    that's why my result would be :

    1) Lucy (lesser x lesser) X Normal = all lesser
    2) Lucy (mojave x lesser) X Normal = 50% lesser and 50% mojave, no lucy or normal produced

    So what do you think ?

  3. #3
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6

    Re: Genetic dilema ...

    Mojave X mojave "lucy" bred to a normal will give you what?
    Mojaves
    Lesser X mojave lucy when bred to a normal will give you what?
    Lessers and Mojaves
    Deborah Stewart


  4. #4
    BPnet Veteran
    Join Date
    11-13-2003
    Location
    Colorado
    Posts
    1,555
    Thanks
    6
    Thanked 247 Times in 186 Posts
    Images: 28

    Re: Genetic dilema ...

    Yes, it looks like lesser, butter, mojave, phantom, Vin Russo high yellow diamonds, mocha, hidden (makes platy with lesser), special (makes crystal with mojave), and several other unnamed newer animals are alleles of each other (i.e. different mutations of the same gene).

    It's also looking like there could be several other separate allele complexes (yellow belly/specter/whirlwind, cinnamon/black pastel, and maybe even fire/flame hypo/sulfur).

  5. #5
    BPnet Veteran
    Join Date
    06-23-2005
    Location
    Montreal, Canada
    Posts
    343
    Thanks
    81
    Thanked 54 Times in 41 Posts

    Re: Genetic dilema ...

    Quote Originally Posted by RandyRemington View Post
    It's also looking like there could be several other separate allele complexes (yellow belly/specter/whirlwind, cinnamon/black pastel, and maybe even fire/flame hypo/sulfur).
    What do you mean by other separate allele complexes ?
    I don't think I understand

  6. #6
    BPnet Veteran
    Join Date
    11-13-2003
    Location
    Colorado
    Posts
    1,555
    Thanks
    6
    Thanked 247 Times in 186 Posts
    Images: 28

    Re: Genetic dilema ...

    Quote Originally Posted by Watever View Post
    What do you mean by other separate allele complexes ?
    I don't think I understand
    By "allele complex" I mean a group of different mutations of the same gene/locus.

    By "separate" I mean at a different locus than the lesser complex gene.

    It's looking like cinnamon and black pastel are two different mutations of the same gene and that gene is not at the same locus as the gene we know from the lesser/butter/phantom/Vin Russo/mocha/hidden/special mutations.

    There isn't a ton of data available yet but it looks like yellow belly, whirlwind, specter (the last two with yellow belly make super stripe), and perhaps another yellow belly like mutation responsible for some unique looking ivories are another complex of different mutations of a common gene at a different location than the lesser or cinnamon complexes.

    It’s even possible that some mutations we have been working with for a long time like albino and caramel might turn out to be alleles. As far as I know, no one has yet bred an albino to a caramel and proved that you get the normal looking double hets expected if they are mutations of different genes. It’s probably not very likely but maybe they will be alleles and neither the albino nor caramel parent will have a normal copy of a common gene and the combo will not look normal.

  7. #7
    BPnet Veteran
    Join Date
    06-23-2005
    Location
    Montreal, Canada
    Posts
    343
    Thanks
    81
    Thanked 54 Times in 41 Posts

    Re: Genetic dilema ...

    I understand what you are talking about the separate allele complexe

    Well, I always tought that the black pastel and the cinnamon was the same gene. I tought someone already mixed both and proven them to be the same. I might be wrong...

    Also, I heard that some people tryed to mix caramel and normal albino together and got double het. But they never been able to get offspring from those double hets (not proving out) cause most of the eggs don't hatch. Meaning it would be lethal. But that's rumor, since I never saw a post or someone who did it, just some people telling it. But I haven't been around enough for this.

  8. #8
    BPnet Veteran
    Join Date
    11-13-2003
    Location
    Colorado
    Posts
    1,555
    Thanks
    6
    Thanked 247 Times in 186 Posts
    Images: 28

    Re: Genetic dilema ...

    It's arguable whether or not cinnamon and black pastel are the same mutation of the same gene or different mutations of the same gene. I'm certainly no expert on either but from what I've read it sounds like there might be some subtle but consistent differences between cinnamon and black pastel indicating that they are different mutations even if of the same gene.

    Same goes for lesser and butter. Some claim they are consistently different but others that if you mixed a group of the two together you couldn't tell them apart. Of course even if we can't tell them apart by looking there could be differences in the mutations of the common gene that might be important somewhere down the line (in supers or combos). Or butter and lesser could be the exact same mutation just imported two different times.

    I know RDR had some trouble trying to cross I think it was lavender and albino with bad eggs but I heard someone else eventually did that cross and proved them incompatible with each other. So it could be that you are hearing about that case. If someone has actually crossed albino and caramel I would sure like to hear about it as there is a really old case that could be explained by them being alleles so it would be nice to finally know one way or the other.

  9. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Genetic dilema ...

    Quote Originally Posted by RandyRemington View Post
    If someone has actually crossed albino and caramel I would sure like to hear about it as there is a really old case that could be explained by them being alleles so it would be nice to finally know one way or the other.
    Could I inquire about the details of this case? Just curious as it may lend to what I said in a previous thread about what a T+/T- double homozygous would be.

    Based on my knowledge of the mutations I believe a double homozygous would be a phenotype T- type because T- would be epistatic to T+.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #10
    BPnet Veteran
    Join Date
    11-13-2003
    Location
    Colorado
    Posts
    1,555
    Thanks
    6
    Thanked 247 Times in 186 Posts
    Images: 28

    Re: Genetic dilema ...

    NERD had an imported male caramel that unexpectedly produced some albino descendents. The generally accepted explanation was that it was both a homozygous caramel and a het for albino. Cory Woods bought a pair of het caramels from NERD and last I heard after several years of breeding them had only produced albinos and not caramels. There are lots of possible explanations like bad luck or an animal mix-up but one that I came was that maybe caramel and albino might be alleles and the imported caramel looking animal was actually a combo of one copy of the caramel mutation and the other copy of the same gene with the albino mutation. Because it was already generally accepted that caramel and albino are mutations of different genes so that a double homozygous would be possible and that it would look like a regular albino there apparently hasn't been anyone interested in possibly wasting a breeding by combining albino and caramel to produce the expected normal looking double hets or eventually the expected albino looking double homozygous. But if they are alleles you might get caramel looking animals from the original albino to caramel breeding but these animals would greatly complicate caramel marketing. But now that caramels aren't as expensive any more someone might eventually do this breeding and report the results.

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1